ID: 954150145

View in Genome Browser
Species Human (GRCh38)
Location 3:48653222-48653244
Sequence TCCAAGTCCCAGCCCACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150145_954150153 16 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150145_954150151 0 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150151 3:48653245-48653267 GGTGAGATCAGAGGGCTCAGAGG 0: 1
1: 0
2: 0
3: 29
4: 299
954150145_954150150 -8 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150145_954150155 29 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150155 3:48653274-48653296 ATATCAGAGGTCAGAACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206
954150145_954150149 -9 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150145_954150156 30 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150156 3:48653275-48653297 TATCAGAGGTCAGAACAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 251
954150145_954150154 28 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150154 3:48653273-48653295 AATATCAGAGGTCAGAACAGTGG 0: 1
1: 0
2: 1
3: 20
4: 253
954150145_954150152 5 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150152 3:48653250-48653272 GATCAGAGGGCTCAGAGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150145 Original CRISPR TCCAAGTCCCAGCCCACATG GGG (reversed) Intronic