ID: 954150147

View in Genome Browser
Species Human (GRCh38)
Location 3:48653224-48653246
Sequence CCTCCAAGTCCCAGCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 403}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150147_954150155 27 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150155 3:48653274-48653296 ATATCAGAGGTCAGAACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206
954150147_954150151 -2 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150151 3:48653245-48653267 GGTGAGATCAGAGGGCTCAGAGG 0: 1
1: 0
2: 0
3: 29
4: 299
954150147_954150152 3 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150152 3:48653250-48653272 GATCAGAGGGCTCAGAGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 264
954150147_954150156 28 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150156 3:48653275-48653297 TATCAGAGGTCAGAACAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 251
954150147_954150154 26 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150154 3:48653273-48653295 AATATCAGAGGTCAGAACAGTGG 0: 1
1: 0
2: 1
3: 20
4: 253
954150147_954150150 -10 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150147_954150153 14 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150147 Original CRISPR CCTCCAAGTCCCAGCCCACA TGG (reversed) Intronic