ID: 954150148

View in Genome Browser
Species Human (GRCh38)
Location 3:48653224-48653246
Sequence CCATGTGGGCTGGGACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 440}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150131_954150148 25 Left 954150131 3:48653176-48653198 CCCCCGATCTAGCTGTGGGCAGA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150132_954150148 24 Left 954150132 3:48653177-48653199 CCCCGATCTAGCTGTGGGCAGAG 0: 1
1: 0
2: 1
3: 17
4: 207
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150134_954150148 22 Left 954150134 3:48653179-48653201 CCGATCTAGCTGTGGGCAGAGAT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150139_954150148 -8 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150133_954150148 23 Left 954150133 3:48653178-48653200 CCCGATCTAGCTGTGGGCAGAGA 0: 1
1: 0
2: 1
3: 21
4: 178
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150138_954150148 -7 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150148 Original CRISPR CCATGTGGGCTGGGACTTGG AGG Intronic