ID: 954150149

View in Genome Browser
Species Human (GRCh38)
Location 3:48653236-48653258
Sequence GGACTTGGAGGTGAGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150139_954150149 4 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150145_954150149 -9 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150138_954150149 5 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150146_954150149 -10 Left 954150146 3:48653223-48653245 CCCATGTGGGCTGGGACTTGGAG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150149 Original CRISPR GGACTTGGAGGTGAGATCAG AGG Intronic