ID: 954150150

View in Genome Browser
Species Human (GRCh38)
Location 3:48653237-48653259
Sequence GACTTGGAGGTGAGATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150138_954150150 6 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150139_954150150 5 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150147_954150150 -10 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150145_954150150 -8 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150146_954150150 -9 Left 954150146 3:48653223-48653245 CCCATGTGGGCTGGGACTTGGAG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150150 Original CRISPR GACTTGGAGGTGAGATCAGA GGG Intronic