ID: 954150153

View in Genome Browser
Species Human (GRCh38)
Location 3:48653261-48653283
Sequence TCAGAGGTCAGGAATATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150139_954150153 29 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150146_954150153 15 Left 954150146 3:48653223-48653245 CCCATGTGGGCTGGGACTTGGAG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150147_954150153 14 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150138_954150153 30 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150145_954150153 16 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150153 Original CRISPR TCAGAGGTCAGGAATATCAG AGG Intronic