ID: 954150155

View in Genome Browser
Species Human (GRCh38)
Location 3:48653274-48653296
Sequence ATATCAGAGGTCAGAACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150147_954150155 27 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150155 3:48653274-48653296 ATATCAGAGGTCAGAACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206
954150145_954150155 29 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150155 3:48653274-48653296 ATATCAGAGGTCAGAACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206
954150146_954150155 28 Left 954150146 3:48653223-48653245 CCCATGTGGGCTGGGACTTGGAG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 954150155 3:48653274-48653296 ATATCAGAGGTCAGAACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150155 Original CRISPR ATATCAGAGGTCAGAACAGT GGG Intronic