ID: 954150156

View in Genome Browser
Species Human (GRCh38)
Location 3:48653275-48653297
Sequence TATCAGAGGTCAGAACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150146_954150156 29 Left 954150146 3:48653223-48653245 CCCATGTGGGCTGGGACTTGGAG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 954150156 3:48653275-48653297 TATCAGAGGTCAGAACAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 251
954150147_954150156 28 Left 954150147 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 3
3: 30
4: 403
Right 954150156 3:48653275-48653297 TATCAGAGGTCAGAACAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 251
954150145_954150156 30 Left 954150145 3:48653222-48653244 CCCCATGTGGGCTGGGACTTGGA 0: 1
1: 0
2: 1
3: 11
4: 224
Right 954150156 3:48653275-48653297 TATCAGAGGTCAGAACAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150156 Original CRISPR TATCAGAGGTCAGAACAGTG GGG Intronic