ID: 954151836

View in Genome Browser
Species Human (GRCh38)
Location 3:48661802-48661824
Sequence GAGCGCATGCGCTTGGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954151825_954151836 20 Left 954151825 3:48661759-48661781 CCCGGGGCGCTGCGGGAGGAAGC 0: 1
1: 0
2: 0
3: 21
4: 236
Right 954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
954151826_954151836 19 Left 954151826 3:48661760-48661782 CCGGGGCGCTGCGGGAGGAAGCG 0: 1
1: 0
2: 1
3: 19
4: 189
Right 954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954151836 Original CRISPR GAGCGCATGCGCTTGGGCGC CGG Exonic
900180340 1:1308421-1308443 GAGCGCCTGCGCTCGGCGGCGGG + Intronic
901667006 1:10831771-10831793 GACCACATGCCCTTGGGGGCTGG + Intergenic
903848936 1:26294876-26294898 GTGCCCATGCGCTTGGCAGCGGG - Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
920198566 1:204245322-204245344 GGGCCCATGTGCTTGGGGGCTGG + Intronic
923082744 1:230674335-230674357 GAAAGCATGCGCTTTGGAGCTGG - Intronic
1062812915 10:478957-478979 GAGCGCTTGCCCCTGGGTGCTGG - Intronic
1065965777 10:30769407-30769429 GAGTGCAGGCGCTGTGGCGCAGG - Intergenic
1076235918 10:128863831-128863853 GAGCTCATGCTCTTGGGCCAGGG - Intergenic
1076710620 10:132331938-132331960 GTGCGCCTGCGCTGGGGCGGGGG - Intergenic
1107294883 13:38897902-38897924 GAGCACATGCGAGTGGGTGCAGG - Intergenic
1112197845 13:97242971-97242993 GAGCGCATGCGCTCCTGTGCAGG + Intronic
1115852051 14:37596300-37596322 GAGAGCAAGGGCCTGGGCGCGGG + Intronic
1117135314 14:52730013-52730035 GAGCGCAGACGCTTGGGGGTGGG - Intergenic
1124154031 15:27209596-27209618 GAGCCCATTCCCTTGGGTGCTGG + Intronic
1124237741 15:28004339-28004361 GAGCGCGTGCTCTGGGGAGCTGG - Intronic
1132315544 15:100887715-100887737 GAGTACATGCACTTGGGGGCCGG + Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132886977 16:2186652-2186674 GAGCCCCTGGGCTTGGGGGCTGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1145963886 17:28903187-28903209 GAGTGTGTGCGCTTGGGCCCTGG + Intergenic
1148027441 17:44598485-44598507 GTGCGCATGCCCTTGGGCTGAGG - Intergenic
1153886910 18:9475485-9475507 GAGGGAATGCGCGTGCGCGCTGG + Intronic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG + Intergenic
1161242046 19:3228074-3228096 GAGGGCAGGCCCTGGGGCGCTGG + Intronic
1163557226 19:17999656-17999678 GAGGCCATGGGCTTGGGTGCTGG + Exonic
1167000267 19:46741641-46741663 GAGCGCATGCTCTGCGGCTCTGG - Intronic
1167561941 19:50231271-50231293 GACCGCATGTCCTTGGGCGCCGG + Intronic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG + Exonic
1168721045 19:58555191-58555213 TTGCGCATGCGCTCGGACGCTGG - Intergenic
927887077 2:26725189-26725211 GAGAGCATGGGCCTGGGGGCAGG - Intronic
927992583 2:27458547-27458569 GAGCAGATGGGCTTGGGAGCTGG - Intronic
928514001 2:32028201-32028223 GATCGCTTGGGCTTGGGCCCAGG - Intronic
934551865 2:95267698-95267720 GAGCGCAGGCACTTTGGCGCAGG - Intergenic
938091277 2:128436379-128436401 GTCTGCATGCACTTGGGCGCCGG + Intergenic
1181469404 22:23128533-23128555 GAGCGCAGCAGCTTGGGCCCAGG + Intronic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
966595222 3:181719724-181719746 GAGGGCTTGGGCTGGGGCGCAGG - Intergenic
968512273 4:1000996-1001018 GAGCGCAGGCCCTGGGGCCCTGG + Intronic
971418891 4:26457622-26457644 GAGTGAATGAGCTAGGGCGCTGG - Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
986818229 5:11436088-11436110 GAGCGCTTGCTCTCGGGGGCTGG + Intronic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1011470434 6:87702300-87702322 GAGCGCTTGCGCACGGGGGCGGG + Intergenic
1044250678 8:90001441-90001463 CGGCGCAGGCGGTTGGGCGCAGG - Exonic
1056413493 9:86354619-86354641 GAGCGAGTGCGCTGGGGCGCCGG - Intergenic
1059395299 9:114030637-114030659 GAGGGCATCCGGTTGGGAGCAGG + Intronic
1061473242 9:130844101-130844123 GAGAGCATGGGCTTGGGAGGTGG - Intronic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1062268808 9:135699593-135699615 GAGCGCATGCGCTATGGGGGCGG - Intergenic
1062474584 9:136720737-136720759 GAGCGCTTGAGCCTGGGCACTGG + Intronic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic