ID: 954152119

View in Genome Browser
Species Human (GRCh38)
Location 3:48662786-48662808
Sequence GGCTCCGGCCGCGGAGTAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954152119_954152122 -9 Left 954152119 3:48662786-48662808 CCATCTACTCCGCGGCCGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 954152122 3:48662800-48662822 GCCGGAGCCCCTCCGGCGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 105
954152119_954152124 -3 Left 954152119 3:48662786-48662808 CCATCTACTCCGCGGCCGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 954152124 3:48662806-48662828 GCCCCTCCGGCGTGCGGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954152119 Original CRISPR GGCTCCGGCCGCGGAGTAGA TGG (reversed) Exonic
902896694 1:19484878-19484900 GGCTGAGGCCACGGAGAAGAGGG + Intronic
903522164 1:23959310-23959332 GGCTTCGGACGCGGAGTTGTGGG + Intronic
906943656 1:50277287-50277309 GGCTCTGGCCTCGGAGTCTAGGG + Intergenic
908473966 1:64470695-64470717 GGCTCCGGGCGCGGGGAAGCGGG - Intergenic
910111609 1:83689626-83689648 GGCTCCTCCCTCGGATTAGATGG + Intergenic
912878879 1:113390127-113390149 GGCTCCAGCCGCCGCGCAGAGGG + Intergenic
913268866 1:117072862-117072884 GTCTCAGGCCCCTGAGTAGAGGG + Intronic
915238457 1:154502451-154502473 GGCGCCAGCCGCGGAGGGGAGGG - Intronic
922308896 1:224369459-224369481 GCCTCAGGCTGCGGAGTAGCTGG - Intronic
922356622 1:224782618-224782640 GGCTCGGGGAGCAGAGTAGAGGG - Intergenic
922674532 1:227542455-227542477 GGCTCCGGCCCAGGAGGAGGAGG - Intergenic
1067684674 10:48459201-48459223 GGCCCCGGCCCCAGAGCAGATGG + Intronic
1070942086 10:80356971-80356993 GGAGCCCGCCGCAGAGTAGAGGG + Intronic
1072071669 10:91923970-91923992 GGCCCAGGCCGCGGAGCACAGGG - Exonic
1077872213 11:6271532-6271554 GGCCCTGGCTGAGGAGTAGAGGG + Exonic
1081832086 11:46122110-46122132 GGCTCGGGCCGCGGAGTTGGGGG - Intergenic
1085941169 11:81207907-81207929 GGCTCAGGCCGCGCAGGAGGCGG - Intergenic
1089524019 11:119084946-119084968 GGCTCCGGCCGGCGAGTACCGGG - Exonic
1091473730 12:752823-752845 GGCACCGGCCCGGGAGGAGACGG + Intronic
1097860841 12:64516882-64516904 GCCTCCGCCTGCGGAGTAGCTGG - Intergenic
1099952527 12:89320395-89320417 GCCTCAGGCTCCGGAGTAGATGG + Intergenic
1103410839 12:120710495-120710517 GGCTGCGGCCGCGGCGTCGGCGG + Exonic
1115935406 14:38546769-38546791 GCCTCAGCCCCCGGAGTAGATGG - Intergenic
1118030405 14:61812818-61812840 CGCTCCGGCCGCGGAGGCCAGGG + Intergenic
1123474999 15:20582919-20582941 GGCTCCGGCAGAGGAGGAGCGGG - Intergenic
1123630584 15:22257697-22257719 GGCACCGGCCGAGGAGCAGAGGG - Intergenic
1123987675 15:25659410-25659432 GGCCCCGGCTGCGCAGGAGAGGG - Intergenic
1124629839 15:31329849-31329871 GGCTCCGGCAGCGGGGTGGCGGG + Intronic
1128078237 15:64841633-64841655 GGCTGCGGCGGGGGAGGAGAGGG - Intergenic
1129725968 15:77901840-77901862 GGCTCTGGGGGCAGAGTAGAGGG + Intergenic
1133295353 16:4749180-4749202 GGCACAGGCCCCGGAGTGGAGGG - Exonic
1138619210 16:58198077-58198099 GGCGGCGGCAGCGGAGAAGAAGG + Intergenic
1141972512 16:87492958-87492980 GGCGCCGGCCGAGGAGCGGAGGG + Intergenic
1142037139 16:87869365-87869387 GGCGCCGGCGGCCGAGGAGAAGG - Exonic
1142762299 17:2049859-2049881 GGCTGGGGACGCGGAGCAGAAGG - Intergenic
1143597295 17:7922995-7923017 GGCTCCGGCCGCTGCGTGGAGGG + Exonic
1152287740 17:79422404-79422426 GGCACCGGCCTGGGAGTGGAGGG - Intronic
1154214741 18:12407897-12407919 GGCTCCGGGCGCGGCGTGGGCGG - Exonic
1154294479 18:13136963-13136985 GGCTCCGAGCGCGGAGGGGAAGG - Intergenic
1158695200 18:59697395-59697417 GGCGGCGGCCGCGGAGGAGCAGG - Intergenic
1160629061 18:80232789-80232811 GGCTCAGGCAGCTGAGGAGAGGG + Intronic
1160941385 19:1621896-1621918 GGCTCCGGGGGCTGAGGAGAAGG + Exonic
1161234878 19:3192864-3192886 CGCTCCGGGCGTGGAGTGGATGG + Intronic
1161808663 19:6459389-6459411 GGCTCCGGCCGCCCAGTTCAGGG + Intronic
1161977695 19:7615496-7615518 GGCTCCAGCCGAGGAGGAGGTGG + Exonic
1165772850 19:38388709-38388731 GGCTCCGGCGGCGCTGGAGACGG - Intronic
1166194417 19:41196584-41196606 GGCTCTGGCCGAGGAATGGATGG + Intronic
1166778502 19:45326941-45326963 GCCTCAGGCCCCGGAGTAGCTGG - Intergenic
927811984 2:26185339-26185361 GGCCCCGGCCCCGGAGTATGTGG + Intronic
931869918 2:66446096-66446118 GGCTGCGACCCCGGAGCAGAGGG + Intronic
938063553 2:128269508-128269530 GGCTCCTGCCGCGCAGGGGAGGG - Intronic
942278544 2:174340338-174340360 GGCTGGCGGCGCGGAGTAGAGGG + Intergenic
945321039 2:208424111-208424133 CGCTCCAGCAGAGGAGTAGAGGG + Intronic
948991644 2:241558790-241558812 GGCTCCTGCCGCGGCGTCGGGGG - Exonic
1170661344 20:18343480-18343502 GGCTCAGCCCCCGGAGTAGCTGG - Intergenic
1174459540 20:50672833-50672855 GGCTCCAGCCCAGGAGGAGATGG - Intronic
1175380147 20:58557286-58557308 TGCTCCGGCTGCTGAGTGGAGGG + Intergenic
1176168430 20:63686405-63686427 GGCTCCGGACACGGAGCCGAGGG - Intronic
1178506345 21:33166311-33166333 GCCTCAGGCCCCCGAGTAGATGG + Intronic
1184285960 22:43471663-43471685 GGCTCAGGCTGCGGAGAGGAGGG - Intronic
951031984 3:17892930-17892952 GGCTGCGGCTGGGGAGGAGATGG - Intronic
954152119 3:48662786-48662808 GGCTCCGGCCGCGGAGTAGATGG - Exonic
954247011 3:49340021-49340043 GGCCGGGGCCGCGGAGGAGATGG - Exonic
954402837 3:50328040-50328062 GCCTCCGGCCGCCGAGGCGAAGG + Exonic
958798668 3:98732649-98732671 GGCGCCAGCCGCGGAGCAGGAGG + Intronic
962795749 3:138848114-138848136 GGCTCCGTCTCCGGAGTAGCTGG + Intergenic
969617451 4:8262029-8262051 GGCCCTGGCGGTGGAGTAGAGGG - Intergenic
970416059 4:15858087-15858109 GGCTACTGCCGTGGAGCAGATGG + Intergenic
971359203 4:25921455-25921477 GGCTCCAGCAGCTGAGGAGATGG + Intronic
979670741 4:123357796-123357818 GCCTCAGGCTGCCGAGTAGATGG + Intergenic
985504444 5:271128-271150 GCCTCAGCCCACGGAGTAGATGG + Intergenic
985743654 5:1634410-1634432 GCCTCAGCCCACGGAGTAGATGG - Intergenic
987303392 5:16616905-16616927 GGCTCCTGCCGCCGAGGAGCAGG - Exonic
997549725 5:134741279-134741301 AGCTCCGGCAGCGGAACAGAGGG + Exonic
1001029735 5:168253538-168253560 GCCTCAGCCCGCGGAGTAGCTGG + Intronic
1004663353 6:17729047-17729069 GGCTCGGGCCGCGCAGGAGCCGG - Intergenic
1024578276 7:50782304-50782326 GGCCCCGGCCGCGGCGGACAGGG - Intronic
1025265243 7:57451132-57451154 GCCTCAGGCTGCGGAGTAGCTGG + Intronic
1026990885 7:74584914-74584936 GCCTCCGCCCCCGGAGTAGCTGG + Intronic
1034509265 7:151520609-151520631 GCCTCGGGCCGCGGTGTGGACGG + Intergenic
1036708003 8:11059495-11059517 GGCGCCGCCCGCGCAGCAGATGG - Intronic
1036723700 8:11200990-11201012 GGCTCCGGCCGCGCGGCCGAGGG + Exonic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1042695306 8:71548202-71548224 GGCTCCGGCTGCAGAGCGGAGGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049460808 8:142726899-142726921 GGCTTCGGCCGCGGAGGTGCTGG + Intergenic
1053477966 9:38395798-38395820 GGCTGCTGCCGAGGAGTAGCGGG - Exonic
1054906631 9:70419095-70419117 GGCTCCGGCCGCGGACTGGCGGG + Intergenic
1055514333 9:77020841-77020863 GGCCGCGGCCGCGGAGCACACGG - Exonic
1057815399 9:98290483-98290505 GGCTCTGGCTGCGGAGAAGCTGG - Exonic
1060886232 9:127154327-127154349 GGCTCCTGCCATGGAGTAGGAGG + Intronic
1062162727 9:135088731-135088753 GGCACCGTCCTCGGAGGAGAAGG - Intronic
1189487332 X:41443670-41443692 GGATCCGGCCTGGGAATAGAGGG - Intergenic
1190059488 X:47201662-47201684 GGTTCTGGCCGGGGAGTTGAAGG + Intronic
1195644270 X:107210531-107210553 GCCTCGGGCCCCTGAGTAGATGG + Intronic