ID: 954152209

View in Genome Browser
Species Human (GRCh38)
Location 3:48663181-48663203
Sequence GGGACACGGTTCAGAACTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954152209_954152219 27 Left 954152209 3:48663181-48663203 CCACTAGTTCTGAACCGTGTCCC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 954152219 3:48663231-48663253 ATGAGCGTTCTCATAGCTCTGGG 0: 1
1: 0
2: 1
3: 4
4: 70
954152209_954152220 30 Left 954152209 3:48663181-48663203 CCACTAGTTCTGAACCGTGTCCC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 954152220 3:48663234-48663256 AGCGTTCTCATAGCTCTGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
954152209_954152218 26 Left 954152209 3:48663181-48663203 CCACTAGTTCTGAACCGTGTCCC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 954152218 3:48663230-48663252 CATGAGCGTTCTCATAGCTCTGG 0: 1
1: 1
2: 1
3: 3
4: 55
954152209_954152215 -1 Left 954152209 3:48663181-48663203 CCACTAGTTCTGAACCGTGTCCC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 954152215 3:48663203-48663225 CGGATTTTGGTCTGAAATTTTGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954152209 Original CRISPR GGGACACGGTTCAGAACTAG TGG (reversed) Intergenic
900402814 1:2479530-2479552 GGGACACGGGTCAGCAGTGGGGG + Intronic
920629951 1:207642411-207642433 TGGACCCGGTTTAGAACTATGGG - Intergenic
923525364 1:234768484-234768506 GGGACATGGGGCAGAACCAGAGG - Intergenic
1073292739 10:102421388-102421410 GGGACCCGGTTCAGGACGTGTGG - Exonic
1075421151 10:122301600-122301622 GGGAAACGGTTCAGGAAGAGGGG + Intronic
1076564871 10:131391607-131391629 TGGACACGCTACAGAACCAGGGG - Intergenic
1079644879 11:22850796-22850818 GGTACAGGGTTCAGAAATGGTGG + Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1105398703 13:20067853-20067875 TGGAATCTGTTCAGAACTAGAGG - Intronic
1114768314 14:25400018-25400040 GGGACACACTTAAGCACTAGTGG - Intergenic
1121005202 14:90486113-90486135 GGTACACAGTGAAGAACTAGAGG + Intergenic
1129868816 15:78928193-78928215 AGGACAAGGGACAGAACTAGAGG + Intronic
1133989890 16:10696516-10696538 GTGACAAGGTACAGAACAAGAGG + Intergenic
1134673639 16:16074276-16074298 GGGCCACGGTTCTCAACTGGAGG - Intronic
1135463286 16:22663544-22663566 GGGAGAAGGTTCAAGACTAGAGG + Intergenic
1138584813 16:57962828-57962850 GGGACACAGGTAAGAACAAGGGG - Exonic
1153418656 18:4879535-4879557 GGGAAATGCTTCATAACTAGAGG - Intergenic
1157102989 18:44746761-44746783 GGGACACAGTAAAGAACAAGCGG + Intronic
1160191800 18:76720872-76720894 TGGAGACGTTTCAGAACTAGAGG + Intergenic
1160256287 18:77250881-77250903 TGGACACGGTGAAGAAGTAGTGG - Exonic
1163246070 19:16095221-16095243 GGGAGACAGTTCAGAAGTACAGG - Intronic
1164153828 19:22576532-22576554 AGGAAAAGGTTCAGAATTAGTGG + Intergenic
1166321645 19:42022590-42022612 GGGACACAGTTGAGGCCTAGGGG - Intronic
1167277141 19:48545439-48545461 GGGGCACGGTCCAGAGCTGGGGG - Intergenic
928583212 2:32729665-32729687 GGGGCGCGGTCCAGAAGTAGGGG - Intronic
930238211 2:48908258-48908280 AGGACACAGTCCTGAACTAGTGG + Intergenic
946099210 2:217304494-217304516 GACACTCGGTGCAGAACTAGAGG + Intronic
947689466 2:232121402-232121424 GGGAGATTGTTCAGAATTAGAGG - Intronic
1175082526 20:56433074-56433096 GGGACGCAGTCCAGAACAAGAGG + Intronic
1181306350 22:21919416-21919438 GCGACAGAGTTCAGAACTTGTGG + Exonic
1181610526 22:24008361-24008383 AGGAAACAGCTCAGAACTAGTGG - Intergenic
950939177 3:16876202-16876224 GGGACAAGGACAAGAACTAGAGG - Intronic
954152209 3:48663181-48663203 GGGACACGGTTCAGAACTAGTGG - Intergenic
954441109 3:50522460-50522482 GGGACAAGGAACAGAACTGGGGG - Intergenic
955228705 3:57080658-57080680 GGGAAAAGGTTGAGGACTAGGGG - Intergenic
961040492 3:123674886-123674908 GGGACAGGTTTCTGAAATAGCGG - Intronic
966138658 3:176730057-176730079 GGTCCCCTGTTCAGAACTAGGGG + Intergenic
996383554 5:122886066-122886088 GGGACAGGGTTCAGAGCAAGTGG + Intronic
1005328567 6:24725961-24725983 GGGACAGGGTTAAGAACCAGAGG + Intergenic
1008523765 6:52387369-52387391 GGGACACGGGTCAGAATTATTGG + Intronic
1009334729 6:62472944-62472966 GGGACAGGCTTCTGAAATAGAGG + Intergenic
1010814044 6:80334052-80334074 GGGAGACATTTCAGAATTAGGGG - Intronic
1018882188 6:167895251-167895273 GGGACACATTTCTTAACTAGGGG + Intronic
1022474153 7:30699471-30699493 GGGGTAAGGGTCAGAACTAGGGG + Intronic
1024257843 7:47551521-47551543 GGGTCAGGGTTCAAAACTACAGG + Intronic
1025014390 7:55427178-55427200 GGTACAAGGTTGAGAACTACTGG - Intronic
1032775898 7:135112416-135112438 AAGACATGGTTCAAAACTAGAGG - Intronic
1033549908 7:142437806-142437828 GGGCCAGGGGTCAGAACTAGAGG + Intergenic
1034378801 7:150670883-150670905 GGGACACAGTTGACAACGAGAGG - Intergenic
1040967639 8:53100514-53100536 GGGACAGAGTTCAGCACTGGGGG + Intergenic
1041230830 8:55749585-55749607 AGCACACAGTTCAGAACTCGAGG - Intronic
1041390085 8:57339958-57339980 GGGACAGGGGTAAGAACGAGAGG + Intergenic
1061442919 9:130618805-130618827 AGGACAGGGTTCAGAACTGGGGG - Intronic
1061812122 9:133168185-133168207 GGGCCACGCTTCAGAAATGGTGG + Intergenic
1187092762 X:16114743-16114765 GGGACAAGGGAGAGAACTAGAGG - Intergenic
1187946016 X:24427085-24427107 GGGACTCTGTCCAGGACTAGAGG - Intergenic
1191994687 X:67080289-67080311 GTGACACGATGCAGACCTAGTGG - Intergenic