ID: 954159265

View in Genome Browser
Species Human (GRCh38)
Location 3:48708793-48708815
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4047
Summary {0: 1, 1: 5, 2: 213, 3: 962, 4: 2866}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159265_954159271 8 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159271 3:48708824-48708846 AGCACTTTGGAGGCCAAGGCAGG 0: 215
1: 861
2: 1780
3: 2752
4: 6068
954159265_954159273 27 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159273 3:48708843-48708865 CAGGATGACTGTTTGAGCCCAGG 0: 1
1: 106
2: 1683
3: 10046
4: 33082
954159265_954159267 -5 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159267 3:48708811-48708833 CACGTGTAATCCTAGCACTTTGG 0: 54
1: 6930
2: 90198
3: 226242
4: 255420
954159265_954159268 -2 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159268 3:48708814-48708836 GTGTAATCCTAGCACTTTGGAGG 0: 2
1: 367
2: 4496
3: 6587
4: 5568
954159265_954159269 4 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159269 3:48708820-48708842 TCCTAGCACTTTGGAGGCCAAGG 0: 30
1: 449
2: 1276
3: 2305
4: 3908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954159265 Original CRISPR ACGTGTGTGAGCCACCACAC GGG (reversed) Intronic