ID: 954159267

View in Genome Browser
Species Human (GRCh38)
Location 3:48708811-48708833
Sequence CACGTGTAATCCTAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578844
Summary {0: 54, 1: 6930, 2: 90198, 3: 226242, 4: 255420}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159259_954159267 19 Left 954159259 3:48708769-48708791 CCAATAAGTAATGGTTCCATAGG 0: 1
1: 0
2: 2
3: 89
4: 103
Right 954159267 3:48708811-48708833 CACGTGTAATCCTAGCACTTTGG 0: 54
1: 6930
2: 90198
3: 226242
4: 255420
954159265_954159267 -5 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159267 3:48708811-48708833 CACGTGTAATCCTAGCACTTTGG 0: 54
1: 6930
2: 90198
3: 226242
4: 255420
954159266_954159267 -6 Left 954159266 3:48708794-48708816 CCGTGTGGTGGCTCACACACGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 954159267 3:48708811-48708833 CACGTGTAATCCTAGCACTTTGG 0: 54
1: 6930
2: 90198
3: 226242
4: 255420
954159264_954159267 3 Left 954159264 3:48708785-48708807 CCATAGGGCCCGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 62
4: 562
Right 954159267 3:48708811-48708833 CACGTGTAATCCTAGCACTTTGG 0: 54
1: 6930
2: 90198
3: 226242
4: 255420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954159267 Original CRISPR CACGTGTAATCCTAGCACTT TGG Intronic
Too many off-targets to display for this crispr