ID: 954159268

View in Genome Browser
Species Human (GRCh38)
Location 3:48708814-48708836
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17020
Summary {0: 2, 1: 367, 2: 4496, 3: 6587, 4: 5568}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159266_954159268 -3 Left 954159266 3:48708794-48708816 CCGTGTGGTGGCTCACACACGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 954159268 3:48708814-48708836 GTGTAATCCTAGCACTTTGGAGG 0: 2
1: 367
2: 4496
3: 6587
4: 5568
954159265_954159268 -2 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159268 3:48708814-48708836 GTGTAATCCTAGCACTTTGGAGG 0: 2
1: 367
2: 4496
3: 6587
4: 5568
954159264_954159268 6 Left 954159264 3:48708785-48708807 CCATAGGGCCCGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 62
4: 562
Right 954159268 3:48708814-48708836 GTGTAATCCTAGCACTTTGGAGG 0: 2
1: 367
2: 4496
3: 6587
4: 5568
954159259_954159268 22 Left 954159259 3:48708769-48708791 CCAATAAGTAATGGTTCCATAGG 0: 1
1: 0
2: 2
3: 89
4: 103
Right 954159268 3:48708814-48708836 GTGTAATCCTAGCACTTTGGAGG 0: 2
1: 367
2: 4496
3: 6587
4: 5568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type