ID: 954159269

View in Genome Browser
Species Human (GRCh38)
Location 3:48708820-48708842
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7968
Summary {0: 30, 1: 449, 2: 1276, 3: 2305, 4: 3908}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159265_954159269 4 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159269 3:48708820-48708842 TCCTAGCACTTTGGAGGCCAAGG 0: 30
1: 449
2: 1276
3: 2305
4: 3908
954159264_954159269 12 Left 954159264 3:48708785-48708807 CCATAGGGCCCGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 62
4: 562
Right 954159269 3:48708820-48708842 TCCTAGCACTTTGGAGGCCAAGG 0: 30
1: 449
2: 1276
3: 2305
4: 3908
954159259_954159269 28 Left 954159259 3:48708769-48708791 CCAATAAGTAATGGTTCCATAGG 0: 1
1: 0
2: 2
3: 89
4: 103
Right 954159269 3:48708820-48708842 TCCTAGCACTTTGGAGGCCAAGG 0: 30
1: 449
2: 1276
3: 2305
4: 3908
954159266_954159269 3 Left 954159266 3:48708794-48708816 CCGTGTGGTGGCTCACACACGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 954159269 3:48708820-48708842 TCCTAGCACTTTGGAGGCCAAGG 0: 30
1: 449
2: 1276
3: 2305
4: 3908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type