ID: 954159271

View in Genome Browser
Species Human (GRCh38)
Location 3:48708824-48708846
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11676
Summary {0: 215, 1: 861, 2: 1780, 3: 2752, 4: 6068}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159264_954159271 16 Left 954159264 3:48708785-48708807 CCATAGGGCCCGTGTGGTGGCTC 0: 1
1: 0
2: 3
3: 62
4: 562
Right 954159271 3:48708824-48708846 AGCACTTTGGAGGCCAAGGCAGG 0: 215
1: 861
2: 1780
3: 2752
4: 6068
954159265_954159271 8 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159271 3:48708824-48708846 AGCACTTTGGAGGCCAAGGCAGG 0: 215
1: 861
2: 1780
3: 2752
4: 6068
954159266_954159271 7 Left 954159266 3:48708794-48708816 CCGTGTGGTGGCTCACACACGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 954159271 3:48708824-48708846 AGCACTTTGGAGGCCAAGGCAGG 0: 215
1: 861
2: 1780
3: 2752
4: 6068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type