ID: 954159273

View in Genome Browser
Species Human (GRCh38)
Location 3:48708843-48708865
Sequence CAGGATGACTGTTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44918
Summary {0: 1, 1: 106, 2: 1683, 3: 10046, 4: 33082}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954159265_954159273 27 Left 954159265 3:48708793-48708815 CCCGTGTGGTGGCTCACACACGT 0: 1
1: 5
2: 213
3: 962
4: 2866
Right 954159273 3:48708843-48708865 CAGGATGACTGTTTGAGCCCAGG 0: 1
1: 106
2: 1683
3: 10046
4: 33082
954159270_954159273 -1 Left 954159270 3:48708821-48708843 CCTAGCACTTTGGAGGCCAAGGC 0: 225
1: 849
2: 1750
3: 2646
4: 5892
Right 954159273 3:48708843-48708865 CAGGATGACTGTTTGAGCCCAGG 0: 1
1: 106
2: 1683
3: 10046
4: 33082
954159266_954159273 26 Left 954159266 3:48708794-48708816 CCGTGTGGTGGCTCACACACGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 954159273 3:48708843-48708865 CAGGATGACTGTTTGAGCCCAGG 0: 1
1: 106
2: 1683
3: 10046
4: 33082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954159273 Original CRISPR CAGGATGACTGTTTGAGCCC AGG Intronic