ID: 954160537

View in Genome Browser
Species Human (GRCh38)
Location 3:48718454-48718476
Sequence GTGGGGTGAAGTAGGTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954160537 Original CRISPR GTGGGGTGAAGTAGGTTTGG CGG (reversed) Intronic
900475405 1:2874069-2874091 CTGGGGTGATGCAGGATTGGGGG + Intergenic
902166640 1:14577482-14577504 GAGGTGAGAAGTAGCTTTGGAGG + Intergenic
902996456 1:20229189-20229211 GTGGGATGAAATGGGGTTGGGGG + Intergenic
903221248 1:21870794-21870816 GTGGTGTGAAGTTGGTGTGGTGG - Intronic
903307793 1:22425515-22425537 GTGGGGTGAAGGATCTTTGCAGG + Intergenic
903500220 1:23796467-23796489 GTGGGGTGAGGTGGGTGAGGTGG + Intronic
903647148 1:24902439-24902461 GTGGCGGGAGGTAGGTATGGTGG + Exonic
903649907 1:24916126-24916148 GTGGGGTGAAGTGGGAGTAGGGG - Intronic
903671366 1:25037775-25037797 GTGGGGTGGGGTAGGGTAGGAGG - Intergenic
904831261 1:33307797-33307819 GTGGGGTGAGGTTGGGGTGGGGG - Intronic
904973800 1:34440677-34440699 TTGGGGTGAAGTAGGGTGTGGGG + Intergenic
904985724 1:34546900-34546922 GTGGGGTGAGGAAAGTTTTGTGG + Intergenic
905203082 1:36326850-36326872 ATGTGGGGAAGCAGGTTTGGGGG + Intronic
906141125 1:43534076-43534098 GTGATGTGAACTAGGTTTGGAGG + Intronic
906769519 1:48471858-48471880 GGAGGGTGAAGGAGGTTTGGGGG + Intronic
907343581 1:53755751-53755773 GTGGGGTGGGGTGGGGTTGGGGG - Intergenic
907471917 1:54679658-54679680 GTGGGTAGAGGTGGGTTTGGCGG + Intronic
907649948 1:56285601-56285623 TTGGGGTGAAGCAGGTGGGGTGG - Intergenic
910483412 1:87683415-87683437 CTGGGGTGAAGTGGGCTTGAGGG - Intergenic
912914492 1:113799400-113799422 GTGGGATGCATTAAGTTTGGGGG + Intronic
913099690 1:115551727-115551749 GTGAGGAGAAGGAGGTTTGGTGG - Intergenic
914570489 1:148911548-148911570 GGGGGGTGAAGGAGGGATGGGGG - Intronic
914602341 1:149218721-149218743 GGGGGGTGAAGGAGGGATGGGGG + Intergenic
914713802 1:150237790-150237812 GTGGGGTGGAGTAGGGAAGGTGG - Intergenic
919823769 1:201489460-201489482 GTGGGGTGAGGGGGGTGTGGTGG + Intronic
919986681 1:202680634-202680656 GTGTGGTTAAGTAGGATTTGGGG - Intronic
920129860 1:203723789-203723811 GTGGGATGATGTGGCTTTGGGGG + Intronic
920698997 1:208203603-208203625 GTGGGGTGGAGTTGCCTTGGCGG - Intronic
923403920 1:233642277-233642299 CTGGAGGGAAGTTGGTTTGGGGG - Intronic
923622330 1:235588828-235588850 GTGGAGTGGAGTAGGTGGGGTGG - Intronic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1071439993 10:85681681-85681703 GTGGGCTGAAGGTGGTGTGGAGG - Intronic
1071719225 10:88126175-88126197 GTGGGGTGAGTTAAGGTTGGAGG + Intergenic
1072631665 10:97150959-97150981 GGGGGGTTACCTAGGTTTGGAGG - Intronic
1075420630 10:122297912-122297934 CTGGGGGGAAGTAGGCCTGGTGG - Intronic
1080001604 11:27356865-27356887 GTGGGGTGGGGTGGGGTTGGGGG + Intronic
1080001618 11:27356890-27356912 GTGGGGTGGGGTGGGGTTGGGGG + Intronic
1080001632 11:27356915-27356937 GTGGGGTGGGGTGGGGTTGGGGG + Intronic
1080326527 11:31080065-31080087 GTGGGGTGATGAAGGTATTGGGG + Intronic
1080913448 11:36629139-36629161 GTGGAGTGAAGTAGTTTGGCTGG + Intronic
1082781238 11:57289095-57289117 GTGTGGTGAAGCAGGGCTGGAGG + Intergenic
1084962735 11:72725879-72725901 TTGGGGTGAGGGAGATTTGGTGG - Intronic
1085722778 11:78928005-78928027 GTAGGGAGATGTGGGTTTGGTGG - Intronic
1085738872 11:79062865-79062887 GTGGGGAGAAGCAGGGTTGCTGG + Intronic
1086131428 11:83406260-83406282 GTGGTGCCAAGTAGCTTTGGTGG + Intergenic
1087010603 11:93510581-93510603 GTGGGGTGCAGTGGGGTTGGGGG - Intronic
1088780762 11:113131898-113131920 GTAAAGGGAAGTAGGTTTGGAGG + Intronic
1088917013 11:114235123-114235145 GTGGGGAGAAGAAGCTTTCGGGG + Intronic
1090406532 11:126479099-126479121 GTGGGGAGAAGGACGTTTGTGGG + Intronic
1091445299 12:541624-541646 GTGGGGTGAAGCATGGTTTGAGG + Intronic
1093396207 12:18685762-18685784 GTGTAATGAAGTAGGATTGGAGG - Intronic
1093442392 12:19214095-19214117 GTAAAATGAAGTAGGTTTGGAGG + Intronic
1093682386 12:22017341-22017363 CTGAGGTGGAGGAGGTTTGGTGG + Intergenic
1094241397 12:28229827-28229849 GTGGCTAGAAGAAGGTTTGGAGG + Intronic
1096717247 12:53499143-53499165 GTGGGGTGGAGGATGATTGGGGG - Intronic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097066982 12:56327893-56327915 CTGGGGTGTAGTTGGATTGGAGG - Intronic
1099596349 12:84671653-84671675 GTGGGGTGCAGGAGGCCTGGAGG - Intergenic
1100060958 12:90575369-90575391 GTGGGGGGAAGATGGTTTGAAGG - Intergenic
1101709646 12:107253258-107253280 GTGATGTGAGGTAGGTTTGAGGG + Intergenic
1101838823 12:108313257-108313279 GTGGGGTGGGGTAGGGTGGGGGG - Intronic
1102450281 12:113036980-113037002 GTGGGGACAGGTGGGTTTGGTGG - Intergenic
1103499229 12:121388053-121388075 GTGGTGGGAAGTAGGCCTGGAGG + Intronic
1103843671 12:123886390-123886412 GAGGGGTGAGGAAGGTTTGCAGG + Intronic
1104272190 12:127292750-127292772 GTTGGATGAGGGAGGTTTGGTGG - Intergenic
1104383610 12:128329434-128329456 GTGTGGTAAAGGTGGTTTGGCGG + Intronic
1105584510 13:21731510-21731532 GTGGGAAGAGGTAGGTTAGGGGG + Intergenic
1107115311 13:36740287-36740309 ATGGGGTGATGTTGGTATGGGGG + Intergenic
1108536867 13:51391918-51391940 CTGGGGAGAAGCAGGTTTAGGGG - Intronic
1113966392 13:114155780-114155802 GTGGGGTGCAGAGGGTTGGGAGG + Intergenic
1114379987 14:22192949-22192971 GTGGGGTGAACTGGGGGTGGAGG + Intergenic
1115273651 14:31582490-31582512 GTGGGGTGAAATGGGGGTGGAGG + Intronic
1118822713 14:69355545-69355567 TTTGGGAGAGGTAGGTTTGGAGG - Exonic
1119086436 14:71743571-71743593 GTGGGGTGAGGTGGGGTTGGCGG + Intergenic
1119632981 14:76250146-76250168 GTGGGGTGCAGTTGGGTTTGCGG - Intronic
1120513645 14:85445120-85445142 GTGGGGTGGAGTAGACTTTGTGG - Intergenic
1121665728 14:95670737-95670759 GTGGGTTGAGGTAGGTGTGAAGG - Intergenic
1121749111 14:96332322-96332344 GTTGGGTGAACTAGGTTGGATGG + Exonic
1121833331 14:97070465-97070487 GTGGGATGAAGTGTGTTTGGCGG - Intergenic
1122606088 14:102948316-102948338 GGGGGGTGGGGTGGGTTTGGAGG + Intronic
1122791516 14:104185844-104185866 GTGGGGTGGGGTGGGTGTGGAGG + Intergenic
1122970373 14:105149917-105149939 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970399 14:105149969-105149991 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970421 14:105150020-105150042 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1126996562 15:54451272-54451294 TTGGGGTGTAGTATTTTTGGTGG + Intronic
1127006564 15:54577428-54577450 GTGGGGGAAAGTAGATTAGGAGG - Intronic
1127305776 15:57704607-57704629 GTGGGGTGAGGGAGGCTTGCGGG + Intronic
1129295237 15:74596505-74596527 GTGGGGAGCATGAGGTTTGGCGG - Exonic
1132334088 15:101032680-101032702 ATGGGGTGAAGTAGGGGTCGAGG + Intronic
1132582771 16:693166-693188 GAGGGGTGAAGTGGGGGTGGGGG + Exonic
1135279166 16:21138970-21138992 GTGGGGTCAAGTAGCTATAGAGG + Intronic
1137405481 16:48185861-48185883 GATGGGGGAAGTAGGTTTGAAGG - Intronic
1137858736 16:51823639-51823661 GTGGTGTGAAGTAAGGTTTGAGG + Intergenic
1137981319 16:53072507-53072529 GTGGGGTGAGGTGGGGTTGGGGG - Intronic
1138605837 16:58088239-58088261 GTGGGGTGGAGTAGGGGAGGTGG + Intergenic
1139136059 16:64206183-64206205 GTGGGGTGAAGTGGGCAGGGTGG + Intergenic
1140297542 16:73724105-73724127 GAGGGGTGAATAAGGTTAGGTGG + Intergenic
1142597115 17:1035328-1035350 GTGGGGGGGAGCAGGTTTAGGGG - Intronic
1143022849 17:3925638-3925660 GTGGAGTGAAGGAGGCGTGGGGG - Intronic
1143149465 17:4798684-4798706 GTGGGGGAAAGGAAGTTTGGGGG - Intergenic
1143634972 17:8159357-8159379 GTGGGGGGAAGAAAGTTTGGGGG + Exonic
1145852501 17:28114728-28114750 ATAGTGTGGAGTAGGTTTGGAGG + Intronic
1147335291 17:39723812-39723834 GGGTGGTGAAGGATGTTTGGAGG + Intronic
1149461508 17:56833605-56833627 GCGGGCTGAGGTAGGTGTGGCGG - Exonic
1151334085 17:73429970-73429992 GTGGGGTGACCTCGGTTTGGAGG + Intronic
1151708808 17:75787938-75787960 GTGGAGGGAAGCAGGTATGGTGG - Intronic
1152146667 17:78572615-78572637 GTGGGGTGGAGTGGGGTGGGGGG + Intronic
1153969261 18:10210442-10210464 GAGGCGTGAAGTAAGTGTGGGGG - Intergenic
1154427648 18:14284312-14284334 GTGGGGTGGGGTGGGTTAGGGGG + Intergenic
1156183941 18:34639539-34639561 GGGGTGTGAAGAAGGCTTGGAGG - Intronic
1163040610 19:14599490-14599512 GTGGGGAAAAGTAGGGGTGGTGG - Intronic
1163103753 19:15111721-15111743 GTGGGGGGAACTCTGTTTGGGGG - Exonic
1163126768 19:15248429-15248451 GTGGGGTGAGGTGGGGTTGGGGG + Intronic
1165900668 19:39167803-39167825 GGGAGGAGAAGTAGGTGTGGAGG + Intronic
1167077489 19:47258270-47258292 AGAGGGTGAAGTAGGTTGGGGGG + Intronic
1167113109 19:47473528-47473550 GTGGGGGGGAGCAGGATTGGGGG - Intergenic
1168694870 19:58398382-58398404 GTGAGGTGAGGCAGGATTGGGGG - Intergenic
925080928 2:1065422-1065444 GTGTGCTGGGGTAGGTTTGGGGG - Intronic
926169915 2:10546523-10546545 GTGGCGTCTAGTAAGTTTGGAGG - Intergenic
928709422 2:33987648-33987670 CGAGGGTGAAGGAGGTTTGGTGG - Intergenic
929557069 2:42932167-42932189 TTGGGGGGAAACAGGTTTGGTGG + Intergenic
931209999 2:60183760-60183782 GTGGTGTGATGTAGATGTGGAGG - Intergenic
931615646 2:64153957-64153979 GTGGGGTGACTCAGGTTGGGAGG - Intergenic
933785769 2:85840323-85840345 GTGCGATGAAGTCAGTTTGGCGG - Exonic
937041349 2:118823112-118823134 GAGGGGTGCTGCAGGTTTGGTGG + Intergenic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
939882875 2:147650068-147650090 TTGGGGTGAAGTGGTTTTGTCGG + Intergenic
941175754 2:162195519-162195541 TTGGGGGGAGGTAGGGTTGGGGG + Intronic
941808303 2:169732223-169732245 GTGGGGTGTGGTAGTTGTGGGGG + Intronic
941809168 2:169738812-169738834 GGGGGAGGAAATAGGTTTGGAGG - Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942261830 2:174172553-174172575 GTGGGGCGGAGTAGGTATCGGGG + Intronic
942716171 2:178895016-178895038 GTGGGGTAGAGTAGGTGAGGAGG - Intronic
943027481 2:182647165-182647187 CTGGGGTGAAGTCATTTTGGAGG - Intergenic
944192163 2:197014958-197014980 ATGGGGTGAAATGGGTATGGGGG + Intronic
946433912 2:219639853-219639875 GTGCTGGGAAGCAGGTTTGGGGG - Intronic
947696606 2:232195558-232195580 GTGGGGTGGGGTAGGGGTGGTGG + Intronic
948612276 2:239177476-239177498 CGGGGGTGAGGTAGGGTTGGGGG + Intronic
948916175 2:241035962-241035984 GTGGGGCGTAGTAGGGGTGGGGG + Intronic
1170951033 20:20936489-20936511 GGGGCGTGGAGAAGGTTTGGTGG - Intergenic
1171449108 20:25223901-25223923 GTGGTGTGGGGTGGGTTTGGGGG - Intronic
1173926646 20:46786041-46786063 GTAGGGTGGAGTGGGGTTGGGGG - Intergenic
1173988686 20:47283020-47283042 GTGGGTTGGAGTGGGTTTGGAGG - Intronic
1175763791 20:61579190-61579212 GTGGGGTAAAGTGAGTTTTGAGG - Intronic
1176310919 21:5148408-5148430 GTGGGGTCCAGTAAGATTGGAGG - Intronic
1179573669 21:42293516-42293538 GTGGTGTGTAGTATGTGTGGTGG - Intronic
1179846136 21:44113627-44113649 GTGGGGTCCAGTAAGATTGGAGG + Intronic
1180782448 22:18528760-18528782 GTGGGGTGAGGTAGGACCGGCGG + Intronic
1181126001 22:20702787-20702809 GTGGGGTGAGGTAGGACCGGCGG + Intergenic
1181239338 22:21468095-21468117 GTGGGGTGAGGTAGGACCGGCGG + Intergenic
1181670794 22:24424654-24424676 GTGGCGGGAACTGGGTTTGGGGG + Intronic
1184254421 22:43278942-43278964 GTGGGCTGAGACAGGTTTGGGGG + Intronic
1184354468 22:43969700-43969722 GTGGGGTGAAGAATGTTCTGGGG + Intronic
1184624514 22:45713736-45713758 GTGGGGAGAAGTAGGGGTTGTGG - Intronic
950226516 3:11239817-11239839 GTGGGGTTAAGTGGGGGTGGGGG - Intronic
950932957 3:16809302-16809324 GTGGGGTGAATCAGGATAGGGGG - Intronic
950965057 3:17140211-17140233 CTGGGGTGCAGTAGGGTGGGTGG + Intergenic
951631527 3:24726652-24726674 GTGGGATAAAGTGGGTTTTGGGG + Intergenic
954160537 3:48718454-48718476 GTGGGGTGAAGTAGGTTTGGCGG - Intronic
954801048 3:53187005-53187027 ATGGGGAGAAGCAGGTCTGGGGG - Intronic
956656412 3:71557462-71557484 ATGAGGTGAAGGAGTTTTGGAGG - Intronic
957131130 3:76223371-76223393 GTGTGGGGAAGTAGGTAGGGGGG + Intronic
958736210 3:98012024-98012046 GTGGGGTGGAGTTGGTGAGGAGG + Intronic
959527406 3:107392674-107392696 GTGGGGTAAACTAGGTTTGGTGG - Intergenic
959948738 3:112154326-112154348 GTAGGATGATGTAGATTTGGTGG + Intronic
961174039 3:124819685-124819707 GTGGGGTGAAGTGGGTGGTGAGG - Intronic
961574369 3:127822862-127822884 ATGGGGACAAGTTGGTTTGGGGG + Exonic
962083971 3:132171357-132171379 CTGGGGTGAGGGAGGATTGGAGG - Intronic
962413420 3:135161418-135161440 GAGGGCAGAAGTAGGTGTGGAGG + Intronic
964607472 3:158572777-158572799 GTGGGGGGAGGAGGGTTTGGGGG + Intronic
967477754 3:189940934-189940956 GTGGGGAGAAGGAGCTGTGGTGG + Intergenic
967705508 3:192645261-192645283 GTGGGGTGAGGCAAGTTAGGAGG + Intronic
968524187 4:1047571-1047593 GTGAGGTGTCCTAGGTTTGGAGG - Intergenic
969452638 4:7283635-7283657 GTGGGGTGACATTGGGTTGGCGG + Intronic
971181131 4:24329434-24329456 GTTGAGTGCAGGAGGTTTGGGGG - Intergenic
973138342 4:46734235-46734257 GTGGTGGGAGGCAGGTTTGGAGG + Intergenic
973610993 4:52635875-52635897 GTGGGGAGAAGTGGGGGTGGAGG + Intronic
974165587 4:58197335-58197357 GTGGGGTCAAGCAGGTTTGGAGG + Intergenic
974534742 4:63160253-63160275 GAGGGGAGAGGTAGTTTTGGGGG - Intergenic
975281050 4:72563373-72563395 GTGTGGTGAAGGAGGTTTAGGGG - Intronic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
984918674 4:184745095-184745117 GTGGGGTGAAGCATGCTTGTTGG + Intergenic
986516267 5:8567064-8567086 AAAGGGGGAAGTAGGTTTGGAGG - Intergenic
987125760 5:14810987-14811009 GTGGGGTGAAGAAGGAAGGGGGG + Intronic
991441455 5:66654298-66654320 CTGGGGTGAAGGATGTTTGATGG - Intronic
992611895 5:78515252-78515274 ATGGGGTGGAATAGGTTGGGTGG - Intronic
996978217 5:129460173-129460195 GTGGGGTGGGGTCGGGTTGGGGG - Intergenic
997910461 5:137866955-137866977 ATGTGGTGAAGTAGGGTAGGTGG - Intergenic
998978466 5:147674125-147674147 CTGGGGGGAATAAGGTTTGGGGG - Intronic
999330821 5:150672271-150672293 GTGGGGCGAGGTGGGGTTGGGGG + Intronic
1000440664 5:161259502-161259524 GTGGGGTGAAGTAGGCTGGAAGG - Intergenic
1000706007 5:164512933-164512955 GGGGGATGAGGTAGTTTTGGGGG - Intergenic
1001010894 5:168097297-168097319 GTGGGATGATGAAGGTTGGGGGG + Intronic
1001689883 5:173625149-173625171 ATGGGGAGAGGTAGGTTGGGAGG - Intergenic
1002589837 5:180282875-180282897 GTAGGGTGAAGAAGATTTGGGGG + Intronic
1002851823 6:1003497-1003519 GTGAGGTGAAGAAGGTTCGCTGG - Intergenic
1003395317 6:5748047-5748069 GTGGGTTGAACTGGGTTTGGAGG - Intronic
1004560901 6:16749628-16749650 CTGGGGTGAAGGAGGCTGGGTGG - Intronic
1007479914 6:42142812-42142834 GTGGGGTGAAGGAGGCGTGCAGG - Intergenic
1007816548 6:44529195-44529217 GTGGGGTAAAGCTGGTTTTGTGG + Intergenic
1007848035 6:44776963-44776985 GTGGGGTACAGGAGTTTTGGTGG - Intergenic
1009452577 6:63818778-63818800 GTGGGGTTAGTTAGGTTTTGAGG - Intronic
1011765521 6:90615496-90615518 TTGGGGTGAGGTCGGTTTAGTGG + Intergenic
1012298066 6:97549377-97549399 GTGTGTTGAAGCAGGTGTGGGGG + Intergenic
1015922474 6:138279840-138279862 GTGGGGAGAAGTAGAGATGGAGG - Intronic
1016492926 6:144627166-144627188 GTGGGGTGGGGTAGGGTTGGGGG + Intronic
1018868082 6:167760719-167760741 GTGGGGTGAGGTGGGGTGGGTGG - Intergenic
1019996009 7:4724976-4724998 GAGAGGAGAAGTGGGTTTGGGGG + Intronic
1023069847 7:36418285-36418307 GAGGGGTGAGGTGGGTGTGGGGG + Intronic
1024306125 7:47931081-47931103 GTACGGTGAAGGAGGTATGGAGG - Intronic
1029146838 7:98452391-98452413 GTGGGGTGGGGTAGGGTGGGAGG + Intergenic
1029465323 7:100721220-100721242 TTGAGGGGAAGAAGGTTTGGGGG + Intronic
1032121759 7:129162051-129162073 GTGTGGTGAAATAGGAATGGTGG - Intronic
1032670932 7:134081774-134081796 ATGGGGAGAAGCAGGTTTGGAGG + Intergenic
1033761483 7:144440978-144441000 GTGGGGTGGAGTTGGGTTAGTGG + Intergenic
1034483757 7:151343413-151343435 GTTGTGTGAATTGGGTTTGGGGG + Intronic
1035731778 8:1858590-1858612 GTGGGATGAAGTAGCTGTAGAGG + Intronic
1036132973 8:6133522-6133544 GGGAGGTGAAGGAGGTCTGGAGG + Intergenic
1037674734 8:21043340-21043362 GTGGGGTGGTGGAAGTTTGGGGG - Intergenic
1037764946 8:21766872-21766894 GTGGGGTGATGTACGTGTGCGGG - Intronic
1041006382 8:53500362-53500384 ATGGGGAGATGTAGGTGTGGTGG - Intergenic
1042883411 8:73520515-73520537 TTGGGGTGAAGTAGTTGTTGAGG - Intronic
1043993866 8:86788689-86788711 GTGAGGTGAAGGAGGTATGTAGG + Intergenic
1045978846 8:108160612-108160634 GTTGTGTGAAGGAGGTTTAGTGG - Intergenic
1046711689 8:117518039-117518061 GTGTGGTAAAGAAGGTTGGGAGG + Intergenic
1046979285 8:120319071-120319093 GTGGTGTGCAGTAGGAGTGGTGG + Intronic
1049468425 8:142764273-142764295 GTAGAGTGGAGTAGATTTGGGGG - Intergenic
1049519571 8:143081009-143081031 GTGGGGTGAGGTGGGTGTTGCGG - Intronic
1049614768 8:143571358-143571380 GTGGGGTGAATGAGGCTGGGGGG - Intronic
1050827473 9:9966657-9966679 ATGGGGAGAAGTGGATTTGGGGG + Intronic
1055370155 9:75589708-75589730 GAGGGGTGAAATGGGTGTGGAGG + Intergenic
1056273679 9:84971767-84971789 GTGGGGAGATGATGGTTTGGTGG + Intronic
1059412788 9:114143639-114143661 GTGGGATGAGGCAGGTGTGGGGG + Intergenic
1060051824 9:120383514-120383536 GTGGGGTGGAGAAGGGGTGGGGG - Intergenic
1060823482 9:126674373-126674395 GTGGGGTGGAGGAGGCTGGGGGG + Intronic
1060952502 9:127612809-127612831 GTGGGGTGAGGGAGGGGTGGAGG - Intronic
1061183337 9:129037581-129037603 CTGGAGTGAAGCAGGCTTGGGGG + Intronic
1061413279 9:130432337-130432359 GTGGGGAGAAGTACCTTTGGGGG - Intronic
1061456866 9:130704909-130704931 GTGCCCTGATGTAGGTTTGGGGG + Intergenic
1061808989 9:133151617-133151639 GTGGGGTGAGGGGGGTATGGGGG + Intergenic
1061999093 9:134207116-134207138 GTGGGGTGTTGTGGGGTTGGCGG - Intergenic
1062028996 9:134353590-134353612 GTGGGGAGAAGCAGTGTTGGAGG - Intronic
1186218560 X:7325763-7325785 GTGTGTAGAAGTAGGATTGGAGG + Intronic
1186432051 X:9513362-9513384 GGGGGGTGCAGAAGATTTGGAGG + Intronic
1187701966 X:21971405-21971427 GTGGGATGGATTAGGTTTGCAGG + Intronic
1190123524 X:47683458-47683480 GTGGGGTGAAGCCTTTTTGGGGG + Intergenic
1190333238 X:49248348-49248370 GTGGGGTGGGGTGGGGTTGGAGG + Intronic
1190744937 X:53316952-53316974 GTGGGCTGAAGCTGGTATGGTGG - Intronic
1191127032 X:56967904-56967926 GTGGGGTAAATTAGGCTTGGTGG + Intergenic
1191767069 X:64709699-64709721 GTGGGGTGCAGGAGCTTGGGTGG + Intergenic
1191988796 X:67010128-67010150 GTGGGGTGGAACAGGATTGGGGG - Intergenic
1192763899 X:74123605-74123627 ATGAGGTAAAGGAGGTTTGGAGG + Intergenic
1196675908 X:118419899-118419921 GTGAGGAGAAGCAGGTTTGTGGG - Intronic
1196695650 X:118608507-118608529 TTGGGGTGAAGAAGGTTCTGTGG - Intronic
1196704195 X:118702643-118702665 GTGGGGAGAAGTAGGTTTATGGG - Intergenic
1197209647 X:123818298-123818320 GTAGGCTGAAGTAATTTTGGGGG - Intergenic