ID: 954161689

View in Genome Browser
Species Human (GRCh38)
Location 3:48727366-48727388
Sequence CCAGAGTGGGGGAGTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 5, 2: 30, 3: 82, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954161689 Original CRISPR CCAGAGTGGGGGAGTTTAAG GGG Intronic
900576361 1:3384357-3384379 CCAGAGTGGGGGAGGCTGGGGGG + Intronic
900755471 1:4431393-4431415 TGGAAGTGGGGGAGTTTAAGTGG + Intergenic
901871466 1:12141248-12141270 CCAGAATGGGGAAGCTCAAGAGG - Intronic
902970338 1:20043726-20043748 CAAGAGTGGGGGAGTTTTAAGGG + Intronic
903395946 1:23001991-23002013 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
905284376 1:36869747-36869769 CCAGAGTGGTGAAGATGAAGTGG + Exonic
905499858 1:38427740-38427762 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
905917338 1:41694953-41694975 CCAGAGTCTGGGAGGTTGAGGGG + Intronic
909729515 1:78874959-78874981 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
910002659 1:82357896-82357918 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
910991922 1:93065362-93065384 ACAGAGTGGGTGAGTTTTATAGG + Intergenic
911034522 1:93526653-93526675 CAAGAGTAGGGGAGTAGAAGTGG + Intronic
911759696 1:101601077-101601099 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
912296550 1:108475608-108475630 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
913176161 1:116274916-116274938 CCAGAGTTGGTGAGTTGCAGAGG + Intergenic
915435983 1:155906814-155906836 CCAGAGTGGGTGAGGTACAGTGG + Intronic
916473364 1:165145130-165145152 TCAGAGTGGGAGAGTTTACATGG - Intergenic
916941869 1:169685534-169685556 CCAGAGTTGGGGAGTTTTAAGGG - Intronic
917586910 1:176436393-176436415 CCATAGTAGGGGAGTTAGAGAGG + Intergenic
917749738 1:178042649-178042671 TCAGAGTTGGGGAGTTTTAAGGG - Intergenic
918714324 1:187768548-187768570 CCAGAGTGGGGCAGTTTTCAGGG + Intergenic
919476477 1:198037452-198037474 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
920908083 1:210189961-210189983 CCGGAGTCGGGGAGTTTTAAGGG - Intergenic
922368577 1:224888115-224888137 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
923772286 1:236948085-236948107 CCAGAGAGGGGGAGGCTCAGAGG + Intergenic
1065260648 10:23920020-23920042 CCAGAATGGGTGACTTAAAGAGG + Intronic
1066103314 10:32136703-32136725 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1066437133 10:35405556-35405578 CCAGAATTGGGGAGTTTTAAGGG + Intronic
1067360482 10:45573871-45573893 CCAGAGTTGGGGAGTGTAAGAGG - Intronic
1067834667 10:49631085-49631107 CCAGAGTTGGTGAGTGTAACTGG + Intronic
1068919992 10:62473310-62473332 GCAAAGTTGGGGAGATTAAGTGG + Intronic
1069243588 10:66173006-66173028 CCTGAGAGAGGGAGTTTAAAGGG + Intronic
1069417627 10:68214896-68214918 CAAGAGTGGGCTAGTGTAAGAGG - Intergenic
1070527353 10:77306680-77306702 ACAGAGAGGGGGTGTTTAGGAGG + Intronic
1071602029 10:86962967-86962989 CCAGAGTGGGGGAGACTAGAGGG + Exonic
1071984370 10:91036044-91036066 CCACAATGGTGGAGTTGAAGGGG - Intergenic
1072223833 10:93349638-93349660 CTACAGTGGGAGAATTTAAGGGG + Intronic
1073394703 10:103208237-103208259 CCAGAGTGGGGGAGTTTCAAGGG - Intergenic
1074952033 10:118346533-118346555 CCAGGGTGGGGAAGTTTCACTGG + Intergenic
1075013570 10:118894615-118894637 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1076688468 10:132208727-132208749 CCTGGGTGGGGGAGTTGACGTGG + Intronic
1077245573 11:1535661-1535683 CCAGTGTGGTGGAGTTTGTGGGG - Intergenic
1078789070 11:14525128-14525150 CCAGAGTGGGGGAGTTTTAAGGG - Intronic
1080227442 11:29976071-29976093 CCACAGTTGGGGAGTTTAAGAGG - Intergenic
1080613271 11:33923806-33923828 CCAGAGTGAGGGATTATAAAGGG - Intergenic
1080912843 11:36622326-36622348 CCAGTGTAGGTGAGTTAAAGAGG + Intronic
1081159779 11:39737070-39737092 CCAGAGTGAGGCAGTTTTAAGGG - Intergenic
1081356890 11:42123247-42123269 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1084354274 11:68626812-68626834 CCAGAGTAGGGGAGTTTTCAGGG - Intergenic
1085934343 11:81124457-81124479 CCATAGTTGGGGAGTTTTAAGGG - Intergenic
1086005098 11:82027892-82027914 CCAGAATTGGGGAGTTTTAAGGG - Intergenic
1088235638 11:107719915-107719937 CCAGAGAAGAGGAGTTTAATTGG - Intergenic
1089167125 11:116485891-116485913 CCAGGGTGCTGGAGTTGAAGAGG - Intergenic
1089637147 11:119822333-119822355 CCAGAGTGGAGGAGCAGAAGTGG + Intergenic
1089953382 11:122549618-122549640 CCAGAGTGGGGGAGTTTTTAGGG - Intergenic
1092192283 12:6529663-6529685 CCACAGTGGGGGCATTGAAGGGG - Intronic
1092474561 12:8807595-8807617 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1095998944 12:48113176-48113198 CGAGAGTTGGGGAGTTTTAAGGG + Intronic
1096559119 12:52423466-52423488 CCAGAGTGGGGCAGTCGATGTGG - Intergenic
1096621574 12:52868914-52868936 CCAGTGAAGGGGAGTGTAAGGGG + Intergenic
1096876813 12:54635844-54635866 GCATAGTGGTGGAGATTAAGTGG + Intergenic
1099762668 12:86941470-86941492 CCAGAGTTGGGGATTTTAAGAGG - Intergenic
1100605722 12:96150550-96150572 CTGGAGTGGCTGAGTTTAAGGGG - Intergenic
1101384381 12:104243407-104243429 CAAGAGTGGGGAAGCTTAAATGG - Intronic
1102604556 12:114058509-114058531 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1105032299 12:132892380-132892402 CCAGAGTGGGGGAGTTTTGAGGG - Intronic
1105962676 13:25356194-25356216 CCAGAGTGGGGCAGGAGAAGGGG + Intergenic
1109352991 13:61207471-61207493 CCAGAGTTGGGGAGTTTAAGAGG - Intergenic
1109499367 13:63215782-63215804 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1109661120 13:65461979-65462001 GCAGAATGGTGGAGTTTAACTGG - Intergenic
1116534703 14:46015462-46015484 CCAGAGTAGGGGAGTTTTCAGGG + Intergenic
1117801266 14:59446752-59446774 CCAGAGTTGGGGAGTTTTAAAGG - Intronic
1118937180 14:70298842-70298864 CTAGAGTGGGGGAGTTTTCAGGG + Intergenic
1119248260 14:73131366-73131388 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1119738212 14:76997496-76997518 TCAGAGTGGGGGAGGGTGAGAGG + Intergenic
1119749971 14:77070279-77070301 CCAGAATGGAGGAGTTTCTGTGG - Intergenic
1120355503 14:83428261-83428283 ACAGAGTGAGGGAGATTAATAGG + Intergenic
1120982623 14:90303992-90304014 CCAAGGTGGAGGAGTTTAACAGG - Exonic
1121193214 14:92047753-92047775 CCAGAGTGGGGGAGTTTTAAGGG + Exonic
1122265480 14:100544757-100544779 CCAGCCTGGGGGTGTGTAAGAGG - Intronic
1122381252 14:101308753-101308775 CCAGAGTGGGGGAGTCTTAAGGG + Intergenic
1124533461 15:30525026-30525048 CCAGAGTGTGGGAGTTAGAAGGG + Intergenic
1124765197 15:32482619-32482641 CCAGAGTGTGGGAGTTAGAAGGG - Intergenic
1127920419 15:63490126-63490148 TCAGAGTTGGGGCCTTTAAGAGG + Intergenic
1128980262 15:72180493-72180515 CCTGAGTGGGGGCGTCTGAGCGG - Intronic
1129263966 15:74384086-74384108 CCAGAGTGCGGGGGTTTAGATGG - Intergenic
1130781143 15:87042317-87042339 CCAGAGTGGGGAGTTTTAAGAGG - Intergenic
1130912821 15:88282725-88282747 GCAGAGTGGGGGCATTAAAGTGG - Intergenic
1131164942 15:90135505-90135527 CCAGAGTGGGGGAATTTTAAGGG - Intergenic
1131706536 15:95002179-95002201 CCAGAGTAGTGGAGTTGAAATGG - Intergenic
1133382019 16:5339161-5339183 CCAGAGGCTGGGAGTTTATGGGG - Intergenic
1133651472 16:7817366-7817388 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1134395410 16:13858112-13858134 CCAGAGTGGGAGAGGCTAAGAGG - Intergenic
1134396752 16:13872216-13872238 CCAGAGTGGGGCAGTTAGAATGG + Intergenic
1137363507 16:47841197-47841219 CTAGAGTTGGGGAGTTTTAAGGG - Intergenic
1137809242 16:51337129-51337151 CCAGGGTGAGTGATTTTAAGGGG - Intergenic
1138164286 16:54785800-54785822 CCAAAGTGGGTGAGTGTGAGAGG + Intergenic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1147764668 17:42825556-42825578 CCACAGTGGGGGATTGCAAGGGG - Intronic
1149220577 17:54412125-54412147 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
1151839673 17:76609001-76609023 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
1152043316 17:77919124-77919146 CTAGAGTTGGGGAGTTTTAAGGG - Intergenic
1152454038 17:80402569-80402591 CCAGAGTTGGGGAATTTAAGAGG - Intergenic
1155033608 18:22005240-22005262 CCAGAGGTGGGGAGTTGCAGGGG - Intergenic
1155908219 18:31477994-31478016 CCAGGGTGGGGGATATTTAGGGG - Exonic
1155994326 18:32313772-32313794 CCAAAGTAGAGGAGTATAAGTGG - Intronic
1156468588 18:37363189-37363211 CGAGGGTGGGGGAGGTTAGGAGG + Intronic
1156915890 18:42464236-42464258 CCAGAGTGGGGAAGTTTTAAGGG - Intergenic
1158131077 18:54153286-54153308 CCAGAGTGAGGGAATGGAAGAGG + Exonic
1159164546 18:64684297-64684319 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1159929769 18:74298519-74298541 CTAGAGTGGGAGAGATTAAGAGG - Intergenic
1161661804 19:5551144-5551166 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1161712182 19:5855087-5855109 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1162274117 19:9639592-9639614 CCAGAGTTGGGGAGTTTTAAGGG + Intronic
1162286757 19:9744494-9744516 CAAGAGTTGGGGAGTTTTAAGGG - Intergenic
1162331239 19:10031094-10031116 CCAGAGTTGGGGACTTTTAAGGG + Intergenic
1163209729 19:15831477-15831499 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
1163487372 19:17596098-17596120 CCAGAGTCGGGGAGTTTTAAGGG - Intergenic
1163900139 19:20093661-20093683 CCAGAGTGGGGGAGTTTTCAGGG + Intronic
1164459148 19:28432901-28432923 CCAGAGTTGGGGAGTTTAAGAGG + Intergenic
1165249320 19:34516653-34516675 CCAGAGTGGGGGAGATTTAAGGG - Intergenic
1166303742 19:41926390-41926412 CCAGATTTGGGGAGTTGAAGGGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166905712 19:46107095-46107117 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1168227910 19:55009837-55009859 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
925611469 2:5706059-5706081 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
925611517 2:5706214-5706236 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
926407846 2:12572429-12572451 CCACAGTTGGGGAGTTTTAGAGG - Intergenic
926411428 2:12606764-12606786 CCTGTTTGGGGGAGTTTAATTGG + Intergenic
929383621 2:41380607-41380629 CCAAAGTTGGGGAGTTTTAAGGG - Intergenic
929684446 2:44022085-44022107 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
931272730 2:60717052-60717074 ACAAAGTGGTGGAGTTTAACTGG - Intergenic
931356102 2:61538515-61538537 GCAGAGTGGGGGAGGGGAAGTGG + Intronic
931825540 2:65996693-65996715 GCAGAGAGGGAGAGTTTAATAGG - Intergenic
932159372 2:69446693-69446715 CCAGAGTTGGGGAGTTTAAGAGG + Intergenic
932611804 2:73205249-73205271 CCAAAGTGAGGGAGTTACAGGGG - Intronic
933586275 2:84182605-84182627 CTAGAGAGTTGGAGTTTAAGAGG + Intergenic
935725961 2:106024288-106024310 CCAAAGTTGGGGAGTAGAAGCGG + Intergenic
936870870 2:117132988-117133010 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
938850578 2:135255462-135255484 GCAGAGTGGGTGAGTTTTATAGG - Intronic
940183766 2:150960976-150960998 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
941718249 2:168786433-168786455 GCAAAATGGGGGAGTTTAACTGG + Intergenic
942464190 2:176190056-176190078 CCAGAGAGGGGAAGTTGGAGGGG - Exonic
943274943 2:185854742-185854764 ACAGAGTTGGAGAGTTTTAGGGG - Intergenic
945610318 2:211992928-211992950 CCAGTGGGTGGGAGTTTAAAAGG + Intronic
945858197 2:215092257-215092279 CCAGAGGTGGGGAGTTTTAAGGG - Intronic
947498529 2:230656255-230656277 CCAGAATGGGGGAGTTGAGGAGG + Intergenic
948295952 2:236860718-236860740 CCAGATTAGTGGAGTTGAAGGGG + Intergenic
1168926383 20:1583707-1583729 ACAGATTGGGGGATTTTCAGGGG + Intronic
1168937821 20:1682148-1682170 ACAGATTGGGGGACTTTGAGGGG + Intergenic
1168940135 20:1703036-1703058 ACAGATTGGGAGAGTTTCAGTGG + Intergenic
1169419889 20:5451397-5451419 CCAGGGTGGTGGAGTTTGTGGGG + Intergenic
1170025803 20:11888878-11888900 ACAGAGTGGGTGAGTTTTATGGG + Intergenic
1172221521 20:33277481-33277503 CCAGAGTGGGAGCCTTTCAGGGG - Intronic
1172797814 20:37554809-37554831 GCAAAATGGTGGAGTTTAAGTGG + Intergenic
1172932388 20:38595753-38595775 CCAGAGTGGGAGAGTTTTCAGGG + Intergenic
1173652118 20:44673028-44673050 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1173781809 20:45762467-45762489 CCAGAGTGGGGGAGTTTTAAGGG - Intronic
1175805128 20:61823190-61823212 CCAGAGTTGGCCAGTTTAAATGG + Intronic
1175829333 20:61953526-61953548 CCTTAGTGGGGGAGCTTCAGAGG + Intronic
1176916883 21:14636338-14636360 CAAGAGTGAGAGAGATTAAGAGG - Intronic
1178114911 21:29407168-29407190 CCTGGGTGGGGGCTTTTAAGGGG + Intronic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1180561029 22:16614299-16614321 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1182429893 22:30293216-30293238 CCTGGGTGGGTGACTTTAAGGGG + Intronic
1184877949 22:47287223-47287245 ACAGAATGGGGGAGGTTGAGTGG - Intergenic
1185285377 22:49997566-49997588 CCAGTGTGGGGGAGGTACAGTGG - Intronic
949190319 3:1242848-1242870 CCAGAGTGGGGGAGTTTTCAGGG + Intronic
949490919 3:4588103-4588125 CCTCAGTGGGGGTGCTTAAGGGG - Intronic
950102323 3:10365466-10365488 CCAGAGTGGGGGAGGGCAGGAGG + Intronic
950151571 3:10691575-10691597 CCAGAGTCGGGGAGCTGACGTGG - Intronic
952296955 3:32070271-32070293 CCAGAGTGGGGTAGTTTTAAGGG - Intronic
952626074 3:35405113-35405135 TCAGATTCAGGGAGTTTAAGTGG - Intergenic
952895141 3:38073700-38073722 CCAGAGTGGGGGAGTTTTCAGGG + Intronic
953073509 3:39546958-39546980 CAAGATGGGGGGAGTTTGAGAGG + Intergenic
953077049 3:39580840-39580862 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
953177277 3:40563646-40563668 CCAGAGTTGGGGAGTTTTCAGGG - Intronic
953841324 3:46392304-46392326 CCAGAGTGGGGTAATTTTAAGGG - Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
954198382 3:49009427-49009449 CAAGACTGGGTGAGTGTAAGGGG - Intronic
955152027 3:56376816-56376838 TAAGAGTGGGGCAGATTAAGAGG + Intronic
955314122 3:57921036-57921058 GCAGAGTGGGGTAGTGGAAGTGG + Intronic
958755614 3:98246655-98246677 CCAGAGTTGGGGAGTTTTAAAGG - Intergenic
960412357 3:117342888-117342910 CCAGAGTGGGGCAGCTGATGTGG - Intergenic
961712626 3:128839219-128839241 CCAGAGTTGGAGAGTTTTAAGGG + Intergenic
961953213 3:130772172-130772194 CCATAGTGGGGAAGCTTAGGAGG - Intergenic
962119613 3:132548078-132548100 GCAGAGAGGGGGAGCTGAAGAGG - Intergenic
963058700 3:141207637-141207659 CAAGAGTGGGGGAGTTTTCAGGG - Intergenic
963319818 3:143799955-143799977 CCAGAGTTGGGAGTTTTAAGAGG - Intronic
963456590 3:145554225-145554247 CCAGAGTTGGGGAGTTTTCAGGG + Intergenic
964060669 3:152518424-152518446 CCAGAGAGGTGGAGGTCAAGGGG - Intergenic
964175959 3:153826319-153826341 CCAGAGTGGGGGAGTTTTTAAGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964940888 3:162157174-162157196 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
965286657 3:166827153-166827175 CAAGAGTGGGGGAGTTTTCAGGG + Intergenic
965335178 3:167425265-167425287 CTAGAGTGGGGGAGTTTTAAGGG - Intergenic
967658037 3:192074127-192074149 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
968015644 3:195330047-195330069 CAAGAGTGGGTGAGTTGATGGGG - Intronic
968413173 4:406555-406577 CCAGAGGGGGGAAGTTTTAAGGG + Intergenic
968653928 4:1770650-1770672 ACAGAGTGGGGGAGTCTTTGGGG - Intergenic
968798914 4:2729211-2729233 ACAGAATGGTGGAGTTTAACTGG + Intronic
969238557 4:5885218-5885240 CTAGAGTGGGGGAGGTGAAGGGG - Intronic
969654015 4:8485819-8485841 CCAGAGTGGGGGAGTTTTCAGGG + Intronic
970423486 4:15926256-15926278 CCCGAGAGGTGGAGTTTAAGTGG - Intergenic
971105265 4:23517574-23517596 CCACAGTGGGGGAGAGCAAGAGG - Intergenic
972071061 4:35019821-35019843 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
972186268 4:36532119-36532141 CCAGAGTTTGTGAGTGTAAGTGG - Intergenic
979146687 4:117254761-117254783 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
980270996 4:130583435-130583457 ACAGAATGGTGGAGTTTAACTGG - Intergenic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
980714489 4:136612947-136612969 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
982318887 4:154058945-154058967 CCAGAGTGAGGGAGTTTTAAGGG - Intergenic
982497035 4:156106520-156106542 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
983713584 4:170750114-170750136 TCAGAGAAGGGGAGTGTAAGAGG + Intergenic
986193606 5:5518212-5518234 CCAGAGTTGGGGAGTTTAAGAGG - Intergenic
986469743 5:8061866-8061888 CCACAGTGAGGGTGTGTAAGGGG - Intergenic
986905852 5:12492457-12492479 CCAGAGTGGGGAGTTTTAAGAGG - Intergenic
987282116 5:16422677-16422699 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
987432340 5:17850614-17850636 CCATGGTGGGGGGGTTTAACAGG + Intergenic
987898440 5:23979555-23979577 CCAAATTGGTGGAGTTTAACTGG + Intronic
989660000 5:43788775-43788797 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
990565049 5:57020026-57020048 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
992491265 5:77247135-77247157 CCAGAGTGGCTGAGGTTTAGGGG - Intronic
993370142 5:87083293-87083315 TCAGAATGGGAGAGTTGAAGTGG - Intergenic
993599941 5:89909636-89909658 CCTGACTGTGGGATTTTAAGTGG + Intergenic
994072037 5:95613318-95613340 CCAGAGTGGGGGAGGGGACGGGG - Intergenic
994375705 5:99014348-99014370 CCAGAGTGAGGGAGTTTTTAAGG + Intergenic
995899295 5:117049418-117049440 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
996357705 5:122615216-122615238 CCTTAGTGGGTGAGTTGAAGTGG - Intergenic
996574917 5:124969645-124969667 CCAGAGGTGGGGAGTTTTAAGGG + Intergenic
996725843 5:126672945-126672967 CCACAGTTGGGGAGTTTTAAGGG + Intergenic
997157371 5:131574533-131574555 CCAGAGTTGGGGAGTTTTAAGGG - Intronic
997678737 5:135734409-135734431 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1000199525 5:158994201-158994223 CCTGGGTGGGGAAGTTAAAGAGG - Intronic
1000293618 5:159893882-159893904 CCAGTCTCTGGGAGTTTAAGAGG + Intergenic
1000383986 5:160656323-160656345 CCACAGTGGGAGTGTTTAATGGG - Intronic
1000913643 5:167052966-167052988 CCAGACTGGAGAATTTTAAGTGG - Intergenic
1001125898 5:169019009-169019031 CCAGAGTGGGGGAGGCAAATTGG - Intronic
1001331376 5:170765087-170765109 CCAGAGTCGGGGAGTTTTCAGGG + Intronic
1001354230 5:171004430-171004452 CCAGACTGGGGGAGTTTTAAGGG + Intronic
1001780678 5:174366399-174366421 CCAGGGTGGGGGAGTCTCATGGG - Intergenic
1002610880 5:180417768-180417790 CAAGAGTGGGGGAGTTTTCAGGG + Intergenic
1002834550 6:855170-855192 ACAGAGTAGGGAAGTTTAAGAGG - Intergenic
1003099814 6:3168533-3168555 CCAGAGTGGGGGAGTTTTAGGGG - Intergenic
1006093257 6:31640617-31640639 CTAGAGAGGGGGAGGTTGAGGGG - Intronic
1006720601 6:36147670-36147692 CCAGAGTGGGGGAGTCTGATGGG - Intergenic
1007300899 6:40867247-40867269 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
1007681326 6:43635737-43635759 GCAGTGTGGGGGAGGTTAAGTGG - Intronic
1010017047 6:71116966-71116988 CCAGAGTGGGGGAGGTGTGGGGG + Intergenic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1011910471 6:92430537-92430559 TCAGAGTGGAGGATTTTAACAGG + Intergenic
1014396145 6:120927843-120927865 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1016114069 6:140260490-140260512 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
1016227843 6:141762067-141762089 CCAGAGGGGGAGAGTTGGAGAGG + Intergenic
1016478960 6:144460773-144460795 CCAGAGTGGAGGAGATTATATGG - Intronic
1017269891 6:152492878-152492900 CCAGAGTGGGGGAGTTTTAAAGG - Intronic
1017604967 6:156123966-156123988 GCAGGGTGGGGGACTTCAAGGGG + Intergenic
1018077681 6:160231163-160231185 CCAGAGTGGGGGAATTTTAAGGG - Intronic
1018138590 6:160804027-160804049 CCAGAATGGGGCACTTTCAGGGG + Intergenic
1018495321 6:164341781-164341803 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
1021172746 7:17416508-17416530 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1021637391 7:22705908-22705930 CTAGAGTGGGGGAGTTTTCAGGG - Intergenic
1022372948 7:29787506-29787528 CAAGAGTGGGGGAGTTTTCAGGG - Intergenic
1022709969 7:32840954-32840976 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
1023136071 7:37053479-37053501 CTTGAGTAGGGAAGTTTAAGAGG - Intronic
1023659151 7:42455378-42455400 CCAGAGTGGGAAAGTGTAAAAGG + Intergenic
1025211331 7:57020812-57020834 CCATGGTGGGGGTGTGTAAGCGG - Intergenic
1025888899 7:65627054-65627076 ATAGAGTGGAGGAGTTGAAGAGG + Intergenic
1026425959 7:70293951-70293973 CCCCAGTGGGGTAGTTTTAGGGG - Intronic
1028589829 7:92482829-92482851 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1030193557 7:106832310-106832332 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1031704534 7:124963683-124963705 CCAGAGTTGGGAAGTTTTAAGGG + Intergenic
1031853550 7:126894914-126894936 ATAGAGTGGAGGAGTTGAAGAGG - Intronic
1033090357 7:138379863-138379885 CCAGAGATGGGGCTTTTAAGAGG - Intergenic
1033464969 7:141581868-141581890 CCAGAGTTGGGGAGTTTTAAGGG + Intronic
1036549742 8:9805608-9805630 CCAGAGTGAGGGAGTTTTAAGGG - Intergenic
1036670793 8:10785976-10785998 CCAGATTAAGGGAGTTTATGTGG + Intronic
1042729789 8:71920049-71920071 CCAGAGTGTGGGAGACCAAGGGG - Intronic
1043598914 8:81916099-81916121 CAAGAGTGGGGGAGTTTTAAGGG - Intergenic
1046200669 8:110923839-110923861 GCAGAGGGGGGGGGTTTAAATGG + Intergenic
1046294194 8:112198492-112198514 CCAGAGTTGGGGAGTTTTCAGGG - Intergenic
1048074476 8:131054049-131054071 CTAGAATGGGGGAGTTTAGGGGG + Intergenic
1048303131 8:133265948-133265970 CCAGAGTGGGGCACTTCAAAGGG - Intronic
1048457303 8:134589923-134589945 CCAGAGTGGTGGTTTGTAAGGGG - Intronic
1049933129 9:475171-475193 GCAAAGTGGCGGAGTTTAATTGG + Intronic
1052058770 9:23934234-23934256 TCAGGGTGGGGGAGTGGAAGTGG + Intergenic
1052218975 9:25997351-25997373 CCAGAGTTGGGGAGTTTTAAGGG - Intergenic
1053135613 9:35648794-35648816 CCAGAGTGGGAGAGAGTGAGTGG + Intergenic
1056044660 9:82703762-82703784 CCAGAGTTGGGGAGTTTTCAGGG + Intergenic
1056363783 9:85883355-85883377 CCAGAGTAGCGGAGTTTTAAGGG - Intergenic
1057068196 9:92074283-92074305 CCAGAGTTGGGGAGTTTTAAGGG - Intronic
1058453820 9:105120912-105120934 CCAGAGTGGTGTAGTTCAAATGG - Intergenic
1059574692 9:115476014-115476036 CGAGAGTTGGGGAGTTTAAGAGG - Intergenic
1060318397 9:122533678-122533700 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
1061253044 9:129437637-129437659 GCAGAGGGGGGAAGGTTAAGCGG + Intergenic
1061976515 9:134070657-134070679 CCTGGGTCGGGGAGATTAAGTGG - Intergenic
1062692028 9:137846785-137846807 TCAGAGTGGGGGAGTTTTAAGGG - Intronic
1185771443 X:2768192-2768214 ACAGATTGGAGGAGATTAAGTGG + Intronic
1186112782 X:6275225-6275247 CCAGAGTGGGGGAGTTTTCAGGG + Intergenic
1186245958 X:7617168-7617190 CCACACTGGTGGAGTTTGAGGGG - Intergenic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1188300977 X:28505467-28505489 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1188835275 X:34947712-34947734 ACAGAGGGGGTGAGTTTAACAGG + Intergenic
1188902490 X:35751046-35751068 CCAGAGTGGCAGAGATCAAGTGG - Intergenic
1189031726 X:37458812-37458834 CCAGAGTAGGGGAGTTTTAAGGG + Intronic
1189040550 X:37538052-37538074 ACAGAGGGGGTGAGTTTAACAGG - Intronic
1189117628 X:38359283-38359305 CCAGAGTGGTGGGGTTCTAGGGG + Intronic
1189694997 X:43654794-43654816 CGAGAGTGGGGGAGTAGACGTGG - Intergenic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1191761355 X:64651579-64651601 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1192148364 X:68696645-68696667 CCAGAGTCGGAGAATTTGAGGGG - Intronic
1192731446 X:73805956-73805978 CCAGAGTGGGAGAGTTTTAAGGG + Intergenic
1192764507 X:74127853-74127875 CCAGAGTTGGGGACTTTTAAGGG + Intergenic
1195016873 X:100789464-100789486 CCAGAGTTGGGGAGTTTTAAGGG + Intergenic
1195841564 X:109181088-109181110 CCAGAGTGGGGGAGTTTTCAGGG - Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1196992611 X:121346036-121346058 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1197471042 X:126865764-126865786 CCAGAGTTGCGGAGTTTTAAGGG - Intergenic
1197783000 X:130175331-130175353 CTAGATTGGGGGAGTTTGACAGG + Intronic
1200007749 X:153099047-153099069 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1200268254 X:154658255-154658277 CCTGAGTGGGGCGGTCTAAGTGG + Intergenic
1200532766 Y:4358447-4358469 CCAGAGTTGGGAGTTTTAAGAGG + Intergenic
1201275763 Y:12296886-12296908 ACAGAGTGGGGGCCTGTAAGAGG - Intergenic
1202062163 Y:20899240-20899262 CAAGAGTTGGGGAGTTTTAAGGG - Intergenic
1202076454 Y:21042126-21042148 CCAGAGTAGGGGAGTTTTCAGGG + Intergenic