ID: 954167716

View in Genome Browser
Species Human (GRCh38)
Location 3:48773721-48773743
Sequence ATGTTTAAGTTAAAGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954167716 Original CRISPR ATGTTTAAGTTAAAGATGGG GGG (reversed) Intronic
901458174 1:9375889-9375911 CTGTCTCAGTGAAAGATGGGGGG - Intergenic
901816825 1:11799090-11799112 ATGTTTAATATAAAAATGGTAGG + Intronic
905417196 1:37812107-37812129 ATGGTTAAGTTTACTATGGGAGG + Exonic
908568320 1:65381858-65381880 ATGTTTAAGACAAAGCTGGTAGG + Intronic
909245199 1:73272134-73272156 ATGTTCAAGTGAAAAATTGGAGG - Intergenic
910297618 1:85666171-85666193 ATGTGTAAGGTAAAGATAGGAGG + Intronic
910451363 1:87349349-87349371 ACCTTTTAGTTCAAGATGGGGGG - Intergenic
910910767 1:92231504-92231526 TTTTTTAAGTTAAAGATCAGTGG - Intronic
916274459 1:162978747-162978769 ATGTTTAACTTGTGGATGGGAGG + Intergenic
916518877 1:165545419-165545441 AAGTTTAACATAAAGATGGAAGG + Intronic
916634763 1:166656650-166656672 GTGATTAAGTTAAAGATTTGGGG + Intergenic
916661987 1:166930980-166931002 ATGTTTCAGTTTAAGATTGATGG + Intronic
919360251 1:196583843-196583865 AAGTTCAGGTTAAAAATGGGTGG + Intronic
920824115 1:209409281-209409303 ATCTATAAGTTAAGGGTGGGTGG - Intergenic
921016899 1:211200275-211200297 ATTTTTAAGTTAGAGAAGAGTGG + Intergenic
923210208 1:231797058-231797080 ATGTAGAATTAAAAGATGGGAGG + Intronic
923953996 1:238993978-238994000 ATCTTTATATTACAGATGGGGGG + Intergenic
924410517 1:243800078-243800100 ATGTTTAAGAGAAGGATGAGAGG - Intronic
1063199870 10:3777590-3777612 ATCTTTAATTTAACGATGTGCGG - Exonic
1063265548 10:4445807-4445829 ATGTTTAAGTTATTGATTTGAGG + Intergenic
1063552891 10:7049761-7049783 ATGTTTCAGTCAATGATGGATGG - Intergenic
1065211150 10:23404404-23404426 AAGCTTAAGTGAAAGAAGGGTGG - Intergenic
1066160710 10:32724544-32724566 ATGTTTCATTTAAAAATGGGGGG + Intronic
1066549479 10:36539835-36539857 ATTATGAAGTTAAAGATGAGTGG - Intergenic
1066567784 10:36738272-36738294 AATTTTATGTTAAAGATGGCCGG + Intergenic
1067243516 10:44516916-44516938 ATGTTTATCTTAAAGATGCAAGG + Intergenic
1068036110 10:51761794-51761816 TTGTTTAAGATAAAGATATGTGG + Intronic
1069671999 10:70214885-70214907 ACGTTTACTTTAAAGATGTGTGG + Intronic
1072385121 10:94916983-94917005 ATAGATAAGTTAAAGATAGGAGG - Intergenic
1072533805 10:96344246-96344268 GTGTTGAAAGTAAAGATGGGGGG - Exonic
1072740738 10:97907653-97907675 ATGTTGAAGATAAATGTGGGAGG + Intronic
1073020673 10:100441174-100441196 ATTTTTAAAATAGAGATGGGGGG + Intergenic
1073071689 10:100798475-100798497 ATGTCCAGTTTAAAGATGGGAGG + Intronic
1074440537 10:113473887-113473909 ATCTTTAATAAAAAGATGGGTGG + Intergenic
1076011457 10:126992521-126992543 ATGTTTGATTTTAAGGTGGGTGG + Intronic
1077698077 11:4413315-4413337 AATTTTAAGTGACAGATGGGTGG - Intergenic
1078193691 11:9116323-9116345 ATGTTTAAGTTTAACAAGGCAGG - Intronic
1079664984 11:23093672-23093694 ATGTTTAAGGAAATGGTGGGTGG - Intergenic
1080635010 11:34116266-34116288 ATGATTAAGAGAAATATGGGAGG + Intronic
1080844477 11:36014883-36014905 ATGTTTAAACAAAAGAAGGGGGG + Intronic
1085018499 11:73190656-73190678 AGGATTTAGTTAAGGATGGGAGG + Intergenic
1085586342 11:77711127-77711149 TTTTTTAAGTTAAAAATGTGTGG - Intronic
1087568590 11:99895405-99895427 AGGTTTCAGTTCAAGATGGCTGG + Intronic
1088909824 11:114182431-114182453 GAGTTTATGTTCAAGATGGGAGG - Intronic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1090033187 11:123225269-123225291 TTGTTTAACATAGAGATGGGGGG - Intergenic
1091162356 11:133436478-133436500 AATTTTAAGTGAAAGATGAGCGG - Intronic
1092757989 12:11782838-11782860 ATGTTTAAGAAAAATATGGGAGG + Intronic
1094468380 12:30779023-30779045 ATGTTGATGTTAATGCTGGGGGG + Intergenic
1095786688 12:46117726-46117748 ATTTTTAAGTAAAAGAAGTGGGG - Intergenic
1097346150 12:58495154-58495176 ATGTTTAAGGTGAAAATGAGTGG + Intergenic
1098646888 12:72913095-72913117 ATGTTCAAATAAAACATGGGTGG + Intergenic
1099074542 12:78089845-78089867 AGGTTTAAGTTAAAGAGGAATGG - Intronic
1100011766 12:89962067-89962089 TTGTTTATCTTAAATATGGGTGG + Intergenic
1100541015 12:95557336-95557358 ATGTTTAACTTCAAGGCGGGTGG - Intergenic
1104819715 12:131668463-131668485 ATGTTTAAGTTAATGACTGATGG - Intergenic
1105988555 13:25594352-25594374 ATAATTAAGTTGAATATGGGTGG + Intronic
1107164666 13:37270457-37270479 ATGTTTAAAATATAGATGTGAGG + Intergenic
1107927279 13:45275149-45275171 ATGTCTAAGTTAAAGAAGCCAGG - Intronic
1108060862 13:46531776-46531798 TTGTTTAAGGTAAAGCTGGTGGG - Intergenic
1108142486 13:47439104-47439126 ACCTTTTAGTTGAAGATGGGCGG - Intergenic
1111646887 13:91042340-91042362 TTATTTAAGTTAAAGCTGGTTGG - Intergenic
1112071179 13:95852237-95852259 ATGGTTGGGATAAAGATGGGGGG - Intronic
1113521022 13:110941059-110941081 ACGTTTTATTTAAAGATAGGAGG - Intergenic
1114887166 14:26867693-26867715 ATGTTTTAGAAAAAGATGAGGGG + Intergenic
1120980309 14:90283443-90283465 ATTTTAAATGTAAAGATGGGTGG + Intronic
1126386799 15:48101605-48101627 ATGTTTAATCTAAAGATGTGTGG + Intergenic
1127413956 15:58738521-58738543 AAGTTAAAGTTCAAGATAGGAGG + Intronic
1128193754 15:65730715-65730737 ATGAGTATGTTAGAGATGGGAGG + Intronic
1129640713 15:77374735-77374757 ATGTTAAAAATAAAGATGGAAGG + Intronic
1131502625 15:92983828-92983850 ATATGAAAGTTAAAGATGTGTGG - Intronic
1131835201 15:96383539-96383561 ATGTTTAGGTAAAAGGAGGGAGG - Intergenic
1134137347 16:11686365-11686387 ATGTTTAAGTAAATTATGGCTGG - Intronic
1135273026 16:21085206-21085228 ATTTTTAAAATAGAGATGGGGGG - Intronic
1135581331 16:23629438-23629460 ATGTTTCTTTTAAATATGGGAGG - Intronic
1135796861 16:25453157-25453179 ATGTTTAAATTAAAAAAGAGAGG - Intergenic
1135825649 16:25725352-25725374 ATGTTTACGTTAAAAACCGGGGG - Intronic
1138885890 16:61079003-61079025 ATGTTTAAGTTACATTTGGAAGG + Intergenic
1140726458 16:77817556-77817578 ATGTTAAAGTCAAAGAGTGGAGG + Intronic
1145044008 17:19598122-19598144 ATGGTAAAGTCAGAGATGGGGGG - Intergenic
1145163654 17:20592832-20592854 ATTGTGAAGTTAAAGATGAGTGG + Intergenic
1147486786 17:40822809-40822831 ATGTTGAAATTGAAAATGGGTGG + Intronic
1149564067 17:57629130-57629152 AGGTTTAAATTAAAGTTGGCTGG + Intronic
1149699057 17:58639938-58639960 ATTTTTAAGATAAAGATGTTTGG + Intronic
1150667149 17:67151889-67151911 ATGGGTAGGTTAGAGATGGGTGG - Intronic
1152001927 17:77651952-77651974 ATGTGCAAGTGACAGATGGGTGG - Intergenic
1153513921 18:5887240-5887262 ATTTATAAATTAAAGGTGGGGGG + Exonic
1153612336 18:6899195-6899217 GTGTTTAAGTTAAAAAAGGAGGG + Intronic
1156703032 18:39847434-39847456 TTCTTTAAGTTAATGATGGCTGG + Intergenic
1157964148 18:52189277-52189299 ATATTTGAGTTAAAAATGAGAGG + Intergenic
1158006062 18:52673195-52673217 GAGTTTAATTTAAAAATGGGAGG - Intronic
1162256496 19:9494428-9494450 ATGTTGCATTAAAAGATGGGAGG + Intronic
1163858039 19:19721603-19721625 ATGTTGAAGTTAAAAATACGAGG - Intronic
1164054365 19:21609450-21609472 TTGTTTAAGTTAAAAAATGGAGG + Intergenic
1164636027 19:29792144-29792166 ATGTCTGAGTTAATGAAGGGTGG + Intergenic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
926471388 2:13263214-13263236 ATGTTTGAGTCAAAGAGGGAAGG + Intergenic
926602318 2:14858536-14858558 ATGTTTAAGTGAAATAAGTGAGG + Intergenic
926900450 2:17746054-17746076 ATTTTTAAGGTAAAAATGGATGG - Intronic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
927050432 2:19322627-19322649 ATATTTTAGTTAAAGATATGTGG - Intergenic
930410187 2:51015727-51015749 TTATTTAAGTTAAAAATGGTTGG - Intronic
933361097 2:81285765-81285787 ATGTATAAGTTAAAAATATGAGG + Intergenic
933473058 2:82751824-82751846 GTTTTTAAGATAAGGATGGGTGG - Intergenic
935233809 2:101121280-101121302 ATGTGTTAGTTAATGATGGGAGG - Intronic
935398587 2:102637059-102637081 ATGAAAAAGTTAAAGATGGGTGG + Intronic
939124657 2:138163068-138163090 ATAATTAAGTGGAAGATGGGAGG + Intergenic
939368191 2:141262959-141262981 ATGTTAAATTTATAGATTGGGGG + Intronic
939847869 2:147269496-147269518 ATGTTTTAGCAAAAGATTGGTGG - Intergenic
941078358 2:161031934-161031956 ATGTTTAAGATAATCATGTGTGG - Intergenic
944741322 2:202615561-202615583 CCTTTTAAGTTAAAGATGGAGGG + Intergenic
944793835 2:203161860-203161882 TTGTTTATTTTAGAGATGGGCGG - Intronic
945163827 2:206921145-206921167 ATGAGTAAGTTAAGAATGGGTGG + Intergenic
948494091 2:238334662-238334684 GTGTGTAAGTTAAAGAAGGGTGG + Intronic
1169573455 20:6931385-6931407 ATGTTCAAGTTAAAGTTGTGAGG + Intergenic
1171000271 20:21407688-21407710 ATTTTTAAATTAGAGATGGGGGG - Intergenic
1171874838 20:30564651-30564673 ACGTTTATGTTAAATATGTGAGG + Intergenic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1175285157 20:57832991-57833013 ATATTTAAGTTAAAGAGAGAGGG + Intergenic
1178399767 21:32275501-32275523 TTGTTCAAGTAAAAGATGTGTGG - Intronic
1178902739 21:36610504-36610526 ATTTTTTATTTAAAAATGGGAGG - Intergenic
1183105036 22:35609510-35609532 AGGTCGAAGTTAAAGAGGGGTGG + Intronic
1184622946 22:45696640-45696662 ATTTTTAAATGAAAAATGGGAGG - Intronic
949514153 3:4792226-4792248 ATGATTAGGTTAAGGATGTGAGG - Intronic
951807216 3:26659056-26659078 ATTCTTATGTTAAAAATGGGAGG + Intronic
952248760 3:31628203-31628225 ATGTGTCAGTTAAAAATGGGGGG + Intronic
952335224 3:32398066-32398088 ATGTTTAAGTTAGAGATAAGTGG + Intronic
954167716 3:48773721-48773743 ATGTTTAAGTTAAAGATGGGGGG - Intronic
954474704 3:50732971-50732993 TTATTTAATTTAAAGATGGGAGG + Intronic
955825087 3:62937564-62937586 ATGTTTAATGTGAAGATGAGAGG + Intergenic
955906583 3:63814133-63814155 ATGTTTAACTTAAAGCTTAGGGG + Intergenic
956359927 3:68437085-68437107 ATGTTTAAAAGAAAGCTGGGAGG + Intronic
956642192 3:71425673-71425695 TTGTTTATTTTAAAGGTGGGGGG + Intronic
957135249 3:76279606-76279628 ATATTTAAATTAAATATAGGTGG - Intronic
957145664 3:76420728-76420750 ATGTTTAATTTAAAAATAGTTGG - Intronic
959586573 3:108030783-108030805 ATGTTTAATTTTAATATGGTGGG - Intergenic
959663664 3:108897460-108897482 ATGTTTAAGTTACACGTGTGAGG + Intergenic
960378642 3:116933264-116933286 ATGTTTAGGTTATAGCTTGGAGG - Intronic
961372324 3:126439267-126439289 GTGGTTAAGCTAAGGATGGGTGG - Intronic
963457682 3:145565721-145565743 ATATTCAAGTTATACATGGGAGG - Intergenic
964939552 3:162139422-162139444 ATTTTTAAGTTAAAAATAGCAGG - Intergenic
965268015 3:166572540-166572562 ATATTTACGTTAAAGATATGGGG + Intergenic
965294691 3:166928852-166928874 ATGTTTAAGTTAAAAAAAAGAGG - Intergenic
967548917 3:190766544-190766566 AAGATTAAGGTAAAGATGGTTGG - Intergenic
967639662 3:191846650-191846672 ATGTTTAAATAAAAGATAGAGGG + Intergenic
970988535 4:22186690-22186712 ATGTTTTATTAAAAGGTGGGGGG + Intergenic
971973023 4:33645462-33645484 AAGGTTCAGTTAAAGATGGAGGG + Intergenic
973071825 4:45869634-45869656 ATGTTTCAGTCAAGGATGGATGG - Intergenic
973108261 4:46367904-46367926 ATGTTTAACTTCAAGGTGGCAGG - Intronic
973176425 4:47211949-47211971 GAGTTTAAGTTAAAGATGTTGGG - Intronic
973980335 4:56303386-56303408 ATATTTTTTTTAAAGATGGGAGG + Intronic
975299480 4:72773449-72773471 ATGATTAACTTAAAGAAGGGAGG - Intergenic
978336001 4:107669762-107669784 ATTTTTATCTTAAAGGTGGGTGG - Intronic
978506076 4:109457881-109457903 ATGCTTAGGTTAAAGATCTGGGG - Intronic
979291185 4:118980764-118980786 CTGGTTTAGTTAAAGAAGGGAGG + Intronic
979308778 4:119177865-119177887 ATATTTTTATTAAAGATGGGAGG - Intronic
979320700 4:119321757-119321779 ATTTTTCAGTTAAAGAGGGAAGG + Intronic
979841795 4:125451217-125451239 ATGTTTAGAGTAAAAATGGGTGG - Exonic
980490417 4:133518327-133518349 ATGTCTAAGACAAAGATGGATGG + Intergenic
981115478 4:140985229-140985251 CTTTTTAAGTTAAAAATGGGAGG - Intronic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
986876331 5:12115456-12115478 ATCTTGATGTTGAAGATGGGGGG + Intergenic
987378168 5:17257398-17257420 AAGATTAAGTAAAAGATCGGTGG - Intronic
988628747 5:32906323-32906345 ATTTTGAAGATAAAGATGGAAGG + Intergenic
988656164 5:33214249-33214271 AGCTTTAAGTTCAAGATGTGAGG + Intergenic
988792970 5:34625686-34625708 AGGTTTAAGTTAAAGTGGGTGGG - Intergenic
989004446 5:36794756-36794778 ATTTTTAAGTTAAATATAGTTGG - Intergenic
990954224 5:61328048-61328070 ATTTCTAAGTTAAAGGAGGGTGG + Intergenic
991092476 5:62706405-62706427 ATGTTAAACTGAAAGATGAGAGG - Intergenic
992909491 5:81381519-81381541 ATTTTTAAGTGAAAGAAGTGAGG + Intronic
995406465 5:111802470-111802492 CTGTTGAAATGAAAGATGGGAGG + Intronic
996379494 5:122848774-122848796 AAGTTTAAGGTAGAAATGGGTGG + Intronic
996897986 5:128508445-128508467 ATTGATAAGTTAAAGATGTGTGG - Intronic
997089932 5:130844748-130844770 ATCTTAAAGTGAAAGTTGGGGGG - Intergenic
997845884 5:137285536-137285558 ATGTTTAAGCTGAATATGAGTGG - Intronic
999000567 5:147917977-147917999 ATGTTTTAGTTTTAGATAGGTGG - Intergenic
999340605 5:150767379-150767401 ATGTTTAGTCTAGAGATGGGAGG - Intergenic
999511996 5:152261954-152261976 ATGTCTATTTTATAGATGGGAGG + Intergenic
999942326 5:156557276-156557298 TTCTTTCAGATAAAGATGGGAGG + Intronic
1000689882 5:164304119-164304141 ATATTTAAGTTGAAGATGATTGG - Intergenic
1001488102 5:172134439-172134461 AATTTTTATTTAAAGATGGGAGG - Intronic
1001653995 5:173335347-173335369 ATGATTACTTTAAAGATGGATGG + Intergenic
1003576496 6:7301264-7301286 TTGTTTAAGTTAGAGATGGATGG - Intronic
1003797718 6:9623708-9623730 ATGATTAAGTTAAAAAAAGGGGG - Intronic
1005638868 6:27775918-27775940 ATATTTAATATAAAAATGGGTGG + Intergenic
1008218222 6:48822163-48822185 ATCTTTAATTTAAAAAAGGGAGG + Intergenic
1009908188 6:69894229-69894251 ATCTTAAAGTTAAAGATGCTAGG - Intronic
1011829979 6:91359758-91359780 AACTTTATGGTAAAGATGGGAGG + Intergenic
1011919312 6:92551458-92551480 ATATTTAAGTTTGAGATGAGTGG + Intergenic
1012799971 6:103813656-103813678 ATGATTAAGTTTAATAAGGGAGG - Intergenic
1012835720 6:104264017-104264039 ATTTTTAAGTGGAAGATGGTGGG - Intergenic
1012942644 6:105431765-105431787 ATTTTTAAGTTAAATGTGGAAGG + Intergenic
1015208651 6:130671022-130671044 ATGTTGAAATGAAAGAAGGGAGG + Intergenic
1016655032 6:146508872-146508894 ATGTTGAATTTATAGATGAGAGG - Intergenic
1021310678 7:19092206-19092228 ATGTGTAATTAAAAGCTGGGTGG - Intronic
1021355361 7:19648453-19648475 ATGTTTAAATGGAAGATTGGTGG + Intergenic
1021424588 7:20485898-20485920 ATATTAAAGATAAAGATGGTCGG + Intergenic
1028273998 7:88828524-88828546 ATGTTTAAATTGAAAATGGATGG - Intronic
1030617174 7:111750172-111750194 ATGGTAAAGGTAAGGATGGGAGG + Intronic
1030850178 7:114474028-114474050 AAGTTTACTTTAAAGAAGGGTGG - Intronic
1030979913 7:116174258-116174280 ATGTATAAAATAAAAATGGGAGG - Intergenic
1031184145 7:118454629-118454651 ATATTTAAGTTAAAGTTGATAGG - Intergenic
1032871935 7:135995074-135995096 ATGTTTAGTTTAAAGATAAGGGG + Intergenic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1037126556 8:15358565-15358587 ATGTTTTATTTAAAAATGGCTGG - Intergenic
1038620128 8:29134773-29134795 ATGTATAATTTAAAGATGTGGGG + Intronic
1038630080 8:29233379-29233401 ATGTTTTAGTTAATAATGGTAGG + Intronic
1039181180 8:34868401-34868423 ATGTTTATGTTAGAAATGGAAGG - Intergenic
1042704362 8:71650793-71650815 ATGGTTCAGTTATAGAAGGGGGG + Intergenic
1044790599 8:95843002-95843024 ATTTTTAAATTTAACATGGGAGG + Intergenic
1046479069 8:114790792-114790814 ATGTTTAATTTATCGATGTGTGG + Intergenic
1046920625 8:119724301-119724323 GTGTTAAAGTGAAAGATGGCAGG - Intergenic
1049227996 8:141466840-141466862 ATGTTTAAGAATGAGATGGGAGG - Intergenic
1050176263 9:2872348-2872370 TTGTATAAGTCAAAGATGGATGG + Intergenic
1051784883 9:20731592-20731614 ATGTTTAATTAATAGATGGATGG - Intronic
1052535404 9:29739841-29739863 ATATTTAATATAAAAATGGGTGG - Intergenic
1053211903 9:36236494-36236516 AAGTTGAAGTGAAAGATGGTCGG - Intronic
1053558712 9:39166216-39166238 ATTTTTAAATTAAAGATAGGTGG - Intronic
1053822839 9:41986451-41986473 ATTTTTAAATTAAAGATAGGTGG - Intronic
1054138399 9:61452725-61452747 ATTTTTAAATTAAAGATAGGTGG + Intergenic
1054607736 9:67200914-67200936 ATTTTTAAATTAAAGATAGGTGG + Intergenic
1055483162 9:76730404-76730426 GTGTTTAAGTTACAGATGCGTGG - Intronic
1056841730 9:90003425-90003447 ATATTTAAGTCAAAGCGGGGGGG + Intergenic
1058498203 9:105582864-105582886 CTGTTTCAGTTAGAGATGGCTGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058730832 9:107848262-107848284 ATATTTTATTTAAACATGGGAGG + Intergenic
1059652935 9:116332702-116332724 ATGTCTGAGTTAAAGGTGGCTGG - Intronic
1059908408 9:119014668-119014690 ATGTTCAAGCAAATGATGGGAGG + Intergenic
1060478342 9:124001133-124001155 ATTTTAAAGTTAAAGAGGTGGGG - Intergenic
1060875250 9:127078487-127078509 ATGCGTAAGTTAAGGCTGGGTGG - Intronic
1186952961 X:14647638-14647660 TTATTTAAGGTAAAGATGGATGG + Intronic
1187496269 X:19798538-19798560 ACGTTTAAGTTAAAGATGATGGG - Intronic
1189390538 X:40572725-40572747 TTTTTTAAATTAGAGATGGGGGG - Intergenic
1189910180 X:45803288-45803310 ATGTTTACGAAAAAGATGGTTGG + Intergenic
1190955027 X:55184439-55184461 ATGGTAAAGTCAGAGATGGGGGG + Intronic
1196458369 X:115905736-115905758 ATGTTTAGGTTTAAACTGGGAGG - Intergenic
1199292242 X:146118254-146118276 ATGTTTAAGTTACTTATGGATGG - Intergenic