ID: 954171840

View in Genome Browser
Species Human (GRCh38)
Location 3:48810005-48810027
Sequence GAGGCACATCATTTCTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954171835_954171840 8 Left 954171835 3:48809974-48809996 CCTACCTTGATCTCCACTATCAT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 954171840 3:48810005-48810027 GAGGCACATCATTTCTTGCTTGG 0: 1
1: 0
2: 1
3: 8
4: 137
954171836_954171840 4 Left 954171836 3:48809978-48810000 CCTTGATCTCCACTATCATCCTA 0: 1
1: 0
2: 4
3: 12
4: 189
Right 954171840 3:48810005-48810027 GAGGCACATCATTTCTTGCTTGG 0: 1
1: 0
2: 1
3: 8
4: 137
954171838_954171840 -5 Left 954171838 3:48809987-48810009 CCACTATCATCCTAGTCTGAGGC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 954171840 3:48810005-48810027 GAGGCACATCATTTCTTGCTTGG 0: 1
1: 0
2: 1
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954171840 Original CRISPR GAGGCACATCATTTCTTGCT TGG Intronic
907639461 1:56171486-56171508 GAGGTACATCATGTCGTGCAGGG - Intergenic
908408762 1:63842515-63842537 GAGGGAGATCATTTCTTCCAAGG + Intronic
909229922 1:73074394-73074416 GCAGCACATCATTATTTGCTGGG + Intergenic
911192477 1:94961418-94961440 GACTCACATCGTTTCATGCTTGG - Intergenic
911201085 1:95044203-95044225 AAGCCACATTATCTCTTGCTGGG + Intronic
915126663 1:153670419-153670441 GAGCCCCATCATTACTTGATGGG - Intronic
916521731 1:165569574-165569596 GAGGCACATCATTTAGGGCCTGG - Intergenic
917187884 1:172382093-172382115 GAGGCAAGGCATTTATTGCTAGG - Intronic
920442731 1:205992033-205992055 GTGGCACAGCATTTCTGCCTGGG - Intronic
924435782 1:244040634-244040656 AAGGGAAAACATTTCTTGCTTGG + Intergenic
1063782907 10:9347362-9347384 GAAGAACTTCATTTCTTGCAGGG + Intergenic
1065755677 10:28928192-28928214 GAGGCACACCATTTCTCACCTGG - Intergenic
1067821663 10:49536428-49536450 GAGGCACAACACATCTTTCTCGG + Intronic
1068744531 10:60515352-60515374 GAGGTTCTTCATTTCATGCTAGG - Intronic
1071724363 10:88181708-88181730 AAGGAACATCATTTCCTGATTGG + Intergenic
1071770746 10:88726794-88726816 GAGCCAGATTATTTCTTACTGGG + Exonic
1072405119 10:95144297-95144319 TAGCCAAATCTTTTCTTGCTTGG + Intergenic
1074081049 10:110168525-110168547 GAGACTCTTCATTTCTAGCTCGG - Intergenic
1074863230 10:117529054-117529076 GAGGCACTGCATTTCCTGATGGG - Intergenic
1078007355 11:7541989-7542011 GAGTCACTTCATCTCTTGCCGGG + Intronic
1078242200 11:9539954-9539976 GAGGCACAGCACTTCTTTCATGG - Intergenic
1078987473 11:16609870-16609892 GAGACACAAGATTTCTTGCTGGG - Intronic
1079430318 11:20383328-20383350 GAGCACCATCATTTCTTGATTGG - Exonic
1079461034 11:20678064-20678086 AAGGCACCTCCTTTCTTGCATGG + Intronic
1080928541 11:36783781-36783803 GAGCCACTTCCTTTCTGGCTAGG + Intergenic
1081044919 11:38261470-38261492 AAGACACATCACCTCTTGCTGGG - Intergenic
1082783772 11:57305384-57305406 GAGGCACATCCTCTCTGGCCAGG - Intronic
1085115566 11:73928680-73928702 GAGGAAGGTCATTTCTGGCTGGG + Intergenic
1085689534 11:78654079-78654101 AAGGCACATCATTCCCAGCTAGG - Exonic
1087429200 11:98030139-98030161 GAAGGCCATCATTTCCTGCTGGG + Intergenic
1088752539 11:112856623-112856645 GACCCTCATCATTTCTTGCCTGG - Intergenic
1089119489 11:116123816-116123838 GATGCTCATCATTCATTGCTGGG + Intergenic
1089918617 11:122185065-122185087 GAGCCACATCATCTTTTTCTTGG + Intergenic
1090999937 11:131901947-131901969 TAGGGAAATCATTTCTTTCTGGG + Intronic
1091123222 11:133074332-133074354 GAGGAACAAAATTTCTTACTTGG - Intronic
1092299502 12:7232378-7232400 GAGGCACATAATGTCTGGTTAGG + Intergenic
1092535660 12:9384520-9384542 TAGGCACAACTTTTCTTTCTGGG - Intergenic
1094084798 12:26577416-26577438 GAGAAACATAATTTCTTGATTGG - Intronic
1094467142 12:30765324-30765346 GAGGCAAATTATTTTTTTCTAGG + Intergenic
1095743907 12:45636067-45636089 GGGGCAGATCCTTTCTGGCTTGG + Intergenic
1102526902 12:113519130-113519152 GAGGCACAATATTACTTGGTAGG + Intergenic
1102692347 12:114771245-114771267 AAGTGTCATCATTTCTTGCTTGG - Intergenic
1102747370 12:115261099-115261121 ATGGCACCTCATTTTTTGCTGGG + Intergenic
1103223051 12:119262285-119262307 GAGTCACATCATCTTTTGCTGGG - Intergenic
1108459285 13:50649085-50649107 GAAGCACATCAAGTCTTACTTGG - Intronic
1110501296 13:76231399-76231421 GAGGCTCAGCAATTCCTGCTGGG + Intergenic
1110871691 13:80459831-80459853 GGAGAACATCATTTCTTGCCTGG - Intergenic
1114788790 14:25632220-25632242 TAGGTAGAACATTTCTTGCTTGG + Intergenic
1115574812 14:34700961-34700983 GAGCCACAACAGTTCTTTCTGGG + Intergenic
1117135166 14:52728731-52728753 AAGGCACATAATATCCTGCTAGG - Intergenic
1118363226 14:65073057-65073079 GAGGCACCTCAGTGCTTGCTTGG + Intronic
1120708727 14:87771545-87771567 GAGGTAGCTCATTGCTTGCTTGG - Intergenic
1121963204 14:98280561-98280583 GAGGCACCTCTTGTCTTTCTTGG + Intergenic
1124139543 15:27065074-27065096 GAGGCACCCCATTGCTTCCTTGG + Intronic
1129767528 15:78179640-78179662 GAGACACAGCACTTCTTCCTGGG - Exonic
1132422186 15:101680019-101680041 GAGGCACCTCATTACTTCCAGGG + Intronic
1136120491 16:28130050-28130072 AAGGCACAGCTTGTCTTGCTGGG - Intronic
1137895041 16:52202974-52202996 GAAGCATATCATCTATTGCTTGG + Intergenic
1142793714 17:2290035-2290057 GATGCACATCATTAGTTGCTAGG + Intronic
1144567471 17:16371861-16371883 GATGCTCATCATATCCTGCTTGG + Intergenic
1149367432 17:55959944-55959966 GAGGCAGAACATTGTTTGCTGGG - Intergenic
1150307031 17:64094299-64094321 CAGGCACAGCATTTGTTCCTGGG + Intronic
1151838457 17:76599990-76600012 GACACACATCACTTCTGGCTGGG - Intergenic
1158800438 18:60901366-60901388 GAATCACATCAATTCTTGATTGG + Intergenic
1160075965 18:75677796-75677818 GAAGCACATCATTAGTTTCTTGG + Intergenic
1160185662 18:76674618-76674640 GAGGAACAGCATTTCTTCCTGGG + Intergenic
1162238833 19:9331230-9331252 GTGGCACATTATTTCTTCATGGG - Intronic
1166383353 19:42367077-42367099 AAGGCACTTTATTTATTGCTTGG - Intronic
1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG + Intronic
928004256 2:27549284-27549306 GAGGCACATAATGTCTGGTTTGG + Intronic
928052176 2:28010509-28010531 GAGGCACATAAGCTCTTACTAGG - Intronic
928594131 2:32844461-32844483 GGAGCACATCATTTCTTACACGG - Intergenic
930051387 2:47218688-47218710 GAGAGAAATTATTTCTTGCTTGG + Intergenic
931641284 2:64382996-64383018 GGTGCACATTTTTTCTTGCTGGG - Intergenic
939059754 2:137406787-137406809 GAAGTACAGCATTTCTTGTTTGG - Intronic
940543304 2:155049793-155049815 CAGGCATATCATTTCCTGATTGG - Intergenic
942085587 2:172440464-172440486 TATTCACATCATTTCTTGCCCGG + Intronic
942351465 2:175057527-175057549 GAGGCACATCATTCCATGCAGGG - Intergenic
944057969 2:195543442-195543464 GAGGGAGATGATTTCTTTCTTGG - Intergenic
947992499 2:234497750-234497772 GAGGCCCAGCCTTTCTTGCCCGG + Intergenic
1173628309 20:44490266-44490288 GAGTAAAATCATTTCCTGCTAGG - Exonic
1181889167 22:26046583-26046605 GAGCACCAGCATTTCTTGCTTGG + Intergenic
1182899799 22:33888427-33888449 CGTGCACATCATTTCTTGGTTGG - Intronic
949504304 3:4712483-4712505 CACGCCCATCATTTGTTGCTGGG - Intronic
949511618 3:4771530-4771552 CAGGTTCATCATTTCTTGTTTGG + Intronic
951399208 3:22210517-22210539 GACCCAAATCATTTCTTTCTTGG - Intronic
951886041 3:27525530-27525552 GAGGGACATCTTTCCTTGCATGG - Intergenic
953670292 3:44956722-44956744 GAGCCACACCATGTCTTGCCCGG + Intronic
954171840 3:48810005-48810027 GAGGCACATCATTTCTTGCTTGG + Intronic
957164825 3:76658817-76658839 GAGTCATATCTTTTCATGCTAGG + Intronic
959175197 3:102900049-102900071 GAGGAAATCCATTTCTTGCTAGG + Intergenic
961022737 3:123522915-123522937 GGGGCACATCATTTCTTCCTTGG - Intronic
961119001 3:124357240-124357262 GAGCCTCATTATCTCTTGCTTGG + Intronic
961494256 3:127279468-127279490 GAGTCCCAACATTTATTGCTGGG + Intergenic
967357735 3:188591588-188591610 GGGCCTCATCATTTCTTGCCTGG + Intronic
970227896 4:13878911-13878933 GACCCTCATCATCTCTTGCTTGG + Intergenic
973647546 4:52965241-52965263 TAGGCCCATCATTTTTTGCGGGG - Intronic
973720655 4:53720322-53720344 AAGTACCATCATTTCTTGCTTGG - Intronic
976703940 4:88002300-88002322 GAGGCATGTCAATTCATGCTGGG + Intergenic
979156178 4:117392993-117393015 GAGACACATCATTACTGGGTTGG + Intergenic
980798636 4:137718243-137718265 GAGGCAGATCCTTCATTGCTGGG - Intergenic
983479452 4:168255100-168255122 GAAGCTCATCATATCTTGCCTGG - Intronic
984766720 4:183405538-183405560 TAGGCACTTCCTTCCTTGCTTGG - Intergenic
985369237 4:189267642-189267664 GATGCACATGATTTCTTCCCAGG + Intergenic
986700303 5:10400919-10400941 GAGTTACATCATTTCTTCATTGG + Intronic
994145598 5:96391644-96391666 CAGGCACTTGATTCCTTGCTGGG - Exonic
994155982 5:96504795-96504817 AAAGCACATCATTTGTTGCCTGG - Intergenic
994223457 5:97223496-97223518 GAGGCAGAGCTGTTCTTGCTTGG + Intergenic
996625363 5:125564156-125564178 GAAAAACATCATTTCTAGCTTGG + Intergenic
997094058 5:130890830-130890852 AAGACTCATCATCTCTTGCTTGG + Intergenic
997459803 5:134044234-134044256 GAGGCCCATCTTCCCTTGCTGGG + Intergenic
999005694 5:147975036-147975058 CAGGGAAATCATTCCTTGCTTGG - Intergenic
1001106746 5:168860905-168860927 GAGGCACAGCATGTCATGCAGGG - Intronic
1001998716 5:176183104-176183126 GAGCCACAGAATTTCTTGGTGGG - Intergenic
1002650284 5:180686727-180686749 GAGCCACAGAATTTCTTGGTGGG - Intergenic
1002690575 5:181046978-181047000 GAGGCACCTCATTGCCCGCTGGG - Intronic
1003682333 6:8268406-8268428 AAGGCACTTCATTTCTTCATGGG - Intergenic
1003926281 6:10880996-10881018 GAGGCACCTAATTTCTACCTTGG + Intronic
1007506686 6:42340990-42341012 AGGGCCCATCATTTCTTCCTGGG + Intronic
1012931490 6:105321979-105322001 GAGGCACACCTATCCTTGCTGGG + Intronic
1014276843 6:119398049-119398071 GAGGCATATTGTTTCTGGCTAGG + Intergenic
1015142288 6:129948993-129949015 GAGTCAAATCAAATCTTGCTAGG + Intergenic
1015176052 6:130310623-130310645 GAAGTACATTATTTATTGCTTGG - Intronic
1015239145 6:131004676-131004698 CAGGCACCTCATTTCTGGGTGGG - Intronic
1015894732 6:138006167-138006189 CAGGCACATCACTTCCTGCCAGG + Intergenic
1017691898 6:156975234-156975256 GATGCACATCATTGATTACTAGG - Intronic
1019007849 6:168817332-168817354 GAGTTACATCATTACTTCCTTGG + Intergenic
1020337476 7:7073077-7073099 GAGTAACATCATTTCTTCCCTGG - Intergenic
1020337502 7:7073281-7073303 GAGTAACATCATCTCTTCCTGGG - Intergenic
1021497460 7:21291667-21291689 GATGCACATCATTACTTGACTGG - Intergenic
1027806933 7:82838276-82838298 GAGGAACAAGATTTCTTGCTTGG + Exonic
1029483547 7:100826558-100826580 AAGGCACAACTTTTCGTGCTAGG - Intronic
1029540252 7:101178574-101178596 GAGGGACAGCATTTCTTGGCCGG + Intronic
1029954971 7:104628920-104628942 GAGGCAAATCATTCATTTCTTGG - Intronic
1032708528 7:134442833-134442855 GAGACACATCATTTCTCTGTTGG - Intronic
1033539863 7:142346527-142346549 AAGTCACATCATTGGTTGCTGGG - Intergenic
1037087072 8:14865603-14865625 CATGAACATCATTGCTTGCTGGG - Intronic
1040985927 8:53294539-53294561 GAGGCACATCCTTCCTTGAAGGG - Intergenic
1051712179 9:19942721-19942743 GAGGCACATGACATCTTCCTGGG - Intergenic
1052510256 9:29408704-29408726 GAACCACATCATTTCCTACTAGG - Intergenic
1053052678 9:34974989-34975011 GCTGCTCATCATTTCTTGCCTGG + Intronic
1059532933 9:115054142-115054164 GAGGCACAATATTTCTTCCAAGG + Intronic
1186823062 X:13311436-13311458 GGGACACATCATTTCTTTCCAGG - Intergenic
1189052622 X:37662757-37662779 GAGCCACATCATTTCATCATAGG - Intronic
1194726748 X:97407671-97407693 TAGGCACTTAATTTCTTGCTTGG - Intronic
1197958516 X:131978839-131978861 AAGCCCCATCATTTCTTCCTAGG - Intergenic
1198215835 X:134553915-134553937 GGGGCAAATAATATCTTGCTGGG + Intergenic