ID: 954176222

View in Genome Browser
Species Human (GRCh38)
Location 3:48847781-48847803
Sequence GTGACAGCGGCGGCGGTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 239}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176222_954176242 30 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176222_954176236 14 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176222_954176229 0 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176222_954176234 10 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176234 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 3
3: 16
4: 150
954176222_954176230 1 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176230 3:48847805-48847827 GGGCAGCCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 12
3: 119
4: 632
954176222_954176238 22 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176222_954176228 -1 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176228 3:48847803-48847825 CTGGGCAGCCGCCGCCGCCGCGG 0: 1
1: 0
2: 7
3: 83
4: 496
954176222_954176232 9 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176232 3:48847813-48847835 GCCGCCGCCGCGGGGACCGACGG 0: 1
1: 1
2: 1
3: 24
4: 191
954176222_954176241 27 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137
954176222_954176240 26 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176222 Original CRISPR GTGACAGCGGCGGCGGTGCC AGG (reversed) Exonic