ID: 954176225

View in Genome Browser
Species Human (GRCh38)
Location 3:48847788-48847810
Sequence CTGCCCAGTGACAGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 198}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176225_954176241 20 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137
954176225_954176230 -6 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176230 3:48847805-48847827 GGGCAGCCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 12
3: 119
4: 632
954176225_954176238 15 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176225_954176243 24 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176225_954176245 29 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176225_954176244 25 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176225_954176236 7 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176225_954176242 23 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176225_954176234 3 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176234 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 3
3: 16
4: 150
954176225_954176229 -7 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176225_954176232 2 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176232 3:48847813-48847835 GCCGCCGCCGCGGGGACCGACGG 0: 1
1: 1
2: 1
3: 24
4: 191
954176225_954176228 -8 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176228 3:48847803-48847825 CTGGGCAGCCGCCGCCGCCGCGG 0: 1
1: 0
2: 7
3: 83
4: 496
954176225_954176240 19 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176225 Original CRISPR CTGCCCAGTGACAGCGGCGG CGG (reversed) Exonic