ID: 954176226

View in Genome Browser
Species Human (GRCh38)
Location 3:48847791-48847813
Sequence CGGCTGCCCAGTGACAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176226_954176240 16 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176226_954176230 -9 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176230 3:48847805-48847827 GGGCAGCCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 12
3: 119
4: 632
954176226_954176241 17 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137
954176226_954176245 26 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176226_954176238 12 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176226_954176232 -1 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176232 3:48847813-48847835 GCCGCCGCCGCGGGGACCGACGG 0: 1
1: 1
2: 1
3: 24
4: 191
954176226_954176243 21 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176226_954176229 -10 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176226_954176234 0 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176234 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 3
3: 16
4: 150
954176226_954176236 4 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176226_954176244 22 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176226_954176242 20 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176226 Original CRISPR CGGCTGCCCAGTGACAGCGG CGG (reversed) Exonic