ID: 954176227

View in Genome Browser
Species Human (GRCh38)
Location 3:48847794-48847816
Sequence CGGCGGCTGCCCAGTGACAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176227_954176243 18 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176227_954176236 1 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176227_954176242 17 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176227_954176245 23 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176227_954176234 -3 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176234 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 3
3: 16
4: 150
954176227_954176232 -4 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176232 3:48847813-48847835 GCCGCCGCCGCGGGGACCGACGG 0: 1
1: 1
2: 1
3: 24
4: 191
954176227_954176244 19 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176227_954176241 14 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137
954176227_954176240 13 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176227_954176238 9 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176227 Original CRISPR CGGCGGCTGCCCAGTGACAG CGG (reversed) Exonic