ID: 954176229

View in Genome Browser
Species Human (GRCh38)
Location 3:48847804-48847826
Sequence TGGGCAGCCGCCGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 13, 3: 83, 4: 477}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176217_954176229 20 Left 954176217 3:48847761-48847783 CCCTACGCTACCACGGCCGACCT 0: 1
1: 0
2: 0
3: 3
4: 16
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176221_954176229 4 Left 954176221 3:48847777-48847799 CCGACCTGGCACCGCCGCCGCTG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176222_954176229 0 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176225_954176229 -7 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176220_954176229 10 Left 954176220 3:48847771-48847793 CCACGGCCGACCTGGCACCGCCG 0: 1
1: 0
2: 3
3: 12
4: 142
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176226_954176229 -10 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176215_954176229 28 Left 954176215 3:48847753-48847775 CCGCGCAACCCTACGCTACCACG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477
954176218_954176229 19 Left 954176218 3:48847762-48847784 CCTACGCTACCACGGCCGACCTG 0: 1
1: 0
2: 1
3: 5
4: 36
Right 954176229 3:48847804-48847826 TGGGCAGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 13
3: 83
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176229 Original CRISPR TGGGCAGCCGCCGCCGCCGC GGG Exonic