ID: 954176233

View in Genome Browser
Species Human (GRCh38)
Location 3:48847814-48847836
Sequence CCCGTCGGTCCCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176233_954176243 -2 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176233_954176240 -7 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176233_954176244 -1 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176233_954176246 11 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176233_954176245 3 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176233_954176242 -3 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176233_954176241 -6 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176233 Original CRISPR CCCGTCGGTCCCCGCGGCGG CGG (reversed) Exonic