ID: 954176233

View in Genome Browser
Species Human (GRCh38)
Location 3:48847814-48847836
Sequence CCCGTCGGTCCCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176233_954176243 -2 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176233_954176241 -6 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176241 3:48847831-48847853 GACGGGCAGGCGAGCTGGACGGG 0: 1
1: 0
2: 2
3: 12
4: 137
954176233_954176242 -3 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176233_954176240 -7 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176233_954176246 11 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176233_954176245 3 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176233_954176244 -1 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176233 Original CRISPR CCCGTCGGTCCCCGCGGCGG CGG (reversed) Exonic
901242602 1:7704161-7704183 CCCGGCGCGCCCTGCGGCGGCGG - Intronic
903448451 1:23437110-23437132 CAGGTCGGTCCCCGGGGCCGGGG - Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
912950745 1:114118652-114118674 CCCGGCTGTCCCCGCGGCTCAGG + Intronic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
918388728 1:184036931-184036953 CCCCTCGCTGCCCGCGCCGGTGG - Intronic
922513212 1:226186690-226186712 GCCGTCTGTCCCCGCTGAGGAGG - Exonic
922753734 1:228082863-228082885 CACGTCGACCCCCGCGGCGGCGG + Intronic
1065101930 10:22340448-22340470 CCCCTAGGACCCCGCGGCGCAGG - Intergenic
1067071895 10:43138515-43138537 CCCGGGTGTCCCCGCGGCGCAGG + Exonic
1069386118 10:67884765-67884787 CCTGTCGGCCCCCGCCGCCGAGG - Exonic
1073059428 10:100724538-100724560 CCCGGCGGGCTCCGCGGCGGCGG + Intergenic
1076657967 10:132036917-132036939 CCCGGCGGTCCCCCCGTGGGCGG + Intergenic
1076876518 10:133218961-133218983 CCCCTCGGGCCCCAAGGCGGGGG + Intronic
1082025049 11:47565579-47565601 CCCGTCGGCCCCCGCGCTCGCGG - Exonic
1083232607 11:61332818-61332840 CCCGGCCGCCCCCGGGGCGGCGG + Intronic
1083741536 11:64713904-64713926 TCTGTCGGAGCCCGCGGCGGGGG - Exonic
1095476246 12:42589793-42589815 CGCGCCGGGCCCCGCGGCCGAGG - Intronic
1096095976 12:48935996-48936018 CCCATCATACCCCGCGGCGGGGG - Exonic
1100807959 12:98307434-98307456 CCCCTCGGTCCCGGCTGCTGAGG + Intergenic
1102370952 12:112382101-112382123 CTCGTCGGCGGCCGCGGCGGCGG - Intronic
1103649642 12:122422639-122422661 CCCGCCCGGCCCCGCGGCGGCGG - Intergenic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1110705896 13:78602059-78602081 CCTGTCGCACCCCGCGGCGGCGG - Exonic
1113507103 13:110824965-110824987 CCCGTCGGTCCGCTGGGAGGTGG - Intergenic
1113806101 13:113110606-113110628 CCCCACGGCCCACGCGGCGGGGG - Intronic
1118388898 14:65280188-65280210 CCCGGCCATCCCCTCGGCGGTGG + Intergenic
1122689118 14:103523181-103523203 CCAGCCAGCCCCCGCGGCGGCGG + Intergenic
1122788571 14:104175031-104175053 CCCGTCGGCCCCCGCACCTGCGG + Exonic
1123036646 14:105474509-105474531 CCGGGCCGTCCCCGGGGCGGCGG - Intronic
1123783559 15:23647444-23647466 CCCATCGGGCCCCCCAGCGGGGG + Exonic
1124477044 15:30044595-30044617 CCCGCCGGGCCTGGCGGCGGGGG - Intergenic
1126767001 15:52019434-52019456 CGCGGCGGGCCCGGCGGCGGCGG + Intronic
1128099908 15:64989973-64989995 CCCGGCGGTCGCCACGGCGACGG + Intronic
1129016719 15:72474865-72474887 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
1129116659 15:73368584-73368606 CCCATTGTTCCCCGCGGGGGCGG - Exonic
1132677519 16:1126817-1126839 CCCGAAGGTCCCCGAGGAGGGGG + Intergenic
1135434973 16:22420715-22420737 CCCGTCTGTCTCCAAGGCGGAGG + Intronic
1136491224 16:30609798-30609820 CCCTTCGCGCCCCGCGGCAGCGG + Intronic
1136912770 16:34158767-34158789 GCCCTCGGTCCCCACCGCGGAGG - Intergenic
1137412926 16:48244627-48244649 CCTGGCTGCCCCCGCGGCGGCGG + Intronic
1138450672 16:57092209-57092231 CCCCTCTGTTCCCGCGTCGGTGG + Intergenic
1139529729 16:67537355-67537377 CCCGTCGGTCCCCTCCCCGAGGG + Intronic
1142067669 16:88072101-88072123 CTCCTCGGACCCCGCGGCGGCGG + Exonic
1142371842 16:89686919-89686941 CCCAGAGTTCCCCGCGGCGGGGG + Intronic
1142709710 17:1716326-1716348 CCCGTCGGCCCCCGGGTGGGCGG - Intergenic
1143161793 17:4876733-4876755 CCGCTCGGTCCCTGCAGCGGTGG + Intronic
1143537329 17:7549161-7549183 CCCGTCGGAGCCAGAGGCGGAGG + Exonic
1147653012 17:42072679-42072701 CCCGTCGGGCCGCCCGGGGGCGG - Intergenic
1150168300 17:62966022-62966044 CCCGTCTCTCCGCGCGGAGGAGG + Intergenic
1152923707 17:83078540-83078562 CCCGGCGGTCCCCGCTGCGATGG - Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1154954587 18:21242104-21242126 CGCGGGGGTCCCCGCTGCGGAGG + Intergenic
1160763785 19:798178-798200 CCCCTCCGGCCCCGGGGCGGAGG - Intronic
1160879597 19:1313404-1313426 CCCCTCGGTGCCCGGGGCGGGGG - Intergenic
1161069013 19:2251261-2251283 CCTGTCGGACCCCGCGGCGCTGG + Exonic
1161802638 19:6424556-6424578 GGCGGCGGTCCCGGCGGCGGCGG - Exonic
1162802336 19:13118405-13118427 CCCGGCGGGCTCCGCAGCGGCGG - Exonic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1163122010 19:15223787-15223809 GACGTCGGAGCCCGCGGCGGAGG - Intergenic
1163442624 19:17329369-17329391 CCCGTGGGTCCTCGCCGGGGTGG - Intronic
1164639338 19:29812586-29812608 CCCGTCCGGCCCCGCGGCGCGGG - Intronic
1166100357 19:40567977-40567999 CCCCGCGACCCCCGCGGCGGCGG + Exonic
1167071765 19:47226268-47226290 GCCCTCAGTCCCCGCGGCCGCGG + Intronic
927982145 2:27380781-27380803 CCCGTGCGTCTCTGCGGCGGCGG - Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
935692621 2:105744892-105744914 CCTGACGATCCCCGCGGCAGCGG - Exonic
936038325 2:109129650-109129672 CTCGCCCGCCCCCGCGGCGGTGG - Exonic
938727292 2:134120144-134120166 CCCTGCGGCTCCCGCGGCGGCGG + Intronic
1169231160 20:3889607-3889629 CGCGTCGGTGCCCGCGGTCGGGG + Exonic
1170821386 20:19758290-19758312 CCCGCAGGTCCCGGAGGCGGGGG - Intergenic
1171724438 20:28603060-28603082 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1171753624 20:29079985-29080007 GGCGACGGTCCCCGCGGAGGCGG - Intergenic
1171768192 20:29301421-29301443 ACCCTCGGTCCCCACCGCGGAGG + Intergenic
1171858905 20:30376938-30376960 GGCGACGGTCCCCGCGGGGGCGG - Intergenic
1174611661 20:51802285-51802307 CCCAGCGGCGCCCGCGGCGGGGG - Exonic
1175887915 20:62302827-62302849 CCGGTCCGCCCCCGCGCCGGCGG - Intronic
1176052648 20:63128627-63128649 CCCGTCGGCCCCCGCGTCCTCGG + Intergenic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176550593 21:8219229-8219251 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176569523 21:8402270-8402292 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176577435 21:8446499-8446521 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1179457088 21:41507506-41507528 CCCAGCGGTCCCCGCCGCGCCGG + Intronic
1179996879 21:44978202-44978224 CCCGTCTGTCCCATCGGCCGGGG - Intergenic
1180297984 22:10961734-10961756 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1184153013 22:42649351-42649373 CGCGACGGTCTCGGCGGCGGCGG - Intronic
1185023938 22:48396914-48396936 CCCCTCGGGCCCTGCAGCGGTGG - Intergenic
1185413439 22:50697589-50697611 CGCTTCGGGCCCCGGGGCGGCGG - Intergenic
1203253485 22_KI270733v1_random:128546-128568 CCCGACGGCCGCCGCGGCGTCGG - Intergenic
1203255492 22_KI270733v1_random:135572-135594 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
953972240 3:47356361-47356383 CCCGTCCTTCCCCTCGCCGGCGG - Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
961383629 3:126511491-126511513 CCCGTCAAGCCCCGAGGCGGCGG - Intronic
973936725 4:55853819-55853841 CCCGGTAGTCCCGGCGGCGGCGG + Exonic
975633050 4:76421149-76421171 CCCGTCACTCCTCGCGGCTGTGG + Intronic
985129661 4:186726767-186726789 CCCGTCCGCGCCCGGGGCGGGGG - Intergenic
986297119 5:6448809-6448831 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
992550155 5:77852032-77852054 CCCGGCGGTGCCCGCGGCGGCGG - Intronic
997963343 5:138338596-138338618 TCCGCTGGTCCCCGGGGCGGGGG - Intronic
1002209850 5:177592142-177592164 CCCGGCAGGCACCGCGGCGGCGG + Exonic
1002722757 5:181273490-181273512 CCCGGCGGCCCCCGCGGTGCAGG - Intergenic
1006425205 6:33959231-33959253 CCCGTCTGTCGCCCCGGGGGCGG + Intergenic
1006642816 6:35497377-35497399 CCCGTCGGTGCCGGGGGCCGTGG + Intergenic
1006770305 6:36547428-36547450 CCAGCCCGTCTCCGCGGCGGGGG - Exonic
1013793685 6:113860425-113860447 CGCGCCGGGCCCGGCGGCGGAGG - Exonic
1019505034 7:1386422-1386444 CCCGTCGGTGCCCAGGGAGGTGG - Intergenic
1022546411 7:31193252-31193274 CCCGGCTGTCCCCGCCGCGCTGG + Intergenic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1030347868 7:108454992-108455014 TCCCTCGGTGCCCGCGGCGCAGG + Intronic
1032344379 7:131106019-131106041 GCCGGCGGTGCCCGGGGCGGTGG - Intergenic
1034228051 7:149497886-149497908 CCCGTCGGGCCCCGCGGGCGGGG - Intergenic
1034264131 7:149773128-149773150 CGCCTGGGTCCCCGCGGCGCGGG - Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039531818 8:38269237-38269259 CCCGGCCCTCCCCGCGGAGGTGG - Intronic
1041124453 8:54621325-54621347 CCCGTCGGCGCCCGCGGCCCTGG + Exonic
1049651418 8:143771561-143771583 CCCGGCGCTCCTCCCGGCGGCGG - Intergenic
1049997796 9:1047921-1047943 CCCGTGGGTCCCAGCGGGGTGGG - Intergenic
1051659187 9:19409640-19409662 CCCGCAGGTCCCCGCGGCTGGGG + Intronic
1051774772 9:20621842-20621864 CCCGCAGCTCCCGGCGGCGGCGG + Intronic
1057152720 9:92809002-92809024 CCCGGCGGTCTGCCCGGCGGCGG + Intergenic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1057489276 9:95508882-95508904 ACCCTCGGACCCCGCGGCGGCGG - Intronic
1060700509 9:125746652-125746674 CCCGTCCCTCCCCCCGGCGCGGG + Intergenic
1062481539 9:136754772-136754794 CCCGAAGGTCCCGTCGGCGGCGG - Intronic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203471888 Un_GL000220v1:118707-118729 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1187547393 X:20267071-20267093 CCCCTGGGTGCGCGCGGCGGTGG - Intronic
1190280158 X:48923963-48923985 CTAGCCGGTCCCCGCGGCAGCGG - Exonic
1200000190 X:153056250-153056272 CCCGGGGGCCCCCGTGGCGGGGG + Intergenic