ID: 954176236

View in Genome Browser
Species Human (GRCh38)
Location 3:48847818-48847840
Sequence CGCCGCGGGGACCGACGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176225_954176236 7 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176220_954176236 24 Left 954176220 3:48847771-48847793 CCACGGCCGACCTGGCACCGCCG 0: 1
1: 0
2: 3
3: 12
4: 142
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176221_954176236 18 Left 954176221 3:48847777-48847799 CCGACCTGGCACCGCCGCCGCTG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176226_954176236 4 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176227_954176236 1 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
954176222_954176236 14 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176236 Original CRISPR CGCCGCGGGGACCGACGGGC AGG Exonic