ID: 954176237

View in Genome Browser
Species Human (GRCh38)
Location 3:48847820-48847842
Sequence CGCCTGCCCGTCGGTCCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176237_954176243 -8 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176243 3:48847835-48847857 GGCAGGCGAGCTGGACGGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 349
954176237_954176245 -3 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176245 3:48847840-48847862 GCGAGCTGGACGGGCGGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 342
954176237_954176248 26 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176248 3:48847869-48847891 GGTTGTGACGCACGCCACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 19
954176237_954176242 -9 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176242 3:48847834-48847856 GGGCAGGCGAGCTGGACGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 358
954176237_954176244 -7 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176237_954176246 5 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176237_954176249 27 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176249 3:48847870-48847892 GTTGTGACGCACGCCACCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176237 Original CRISPR CGCCTGCCCGTCGGTCCCCG CGG (reversed) Exonic