ID: 954176238

View in Genome Browser
Species Human (GRCh38)
Location 3:48847826-48847848
Sequence GGACCGACGGGCAGGCGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176225_954176238 15 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176227_954176238 9 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176226_954176238 12 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176222_954176238 22 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176221_954176238 26 Left 954176221 3:48847777-48847799 CCGACCTGGCACCGCCGCCGCTG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
954176231_954176238 -8 Left 954176231 3:48847811-48847833 CCGCCGCCGCCGCGGGGACCGAC 0: 1
1: 0
2: 5
3: 40
4: 376
Right 954176238 3:48847826-48847848 GGACCGACGGGCAGGCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176238 Original CRISPR GGACCGACGGGCAGGCGAGC TGG Exonic