ID: 954176240

View in Genome Browser
Species Human (GRCh38)
Location 3:48847830-48847852
Sequence CGACGGGCAGGCGAGCTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176231_954176240 -4 Left 954176231 3:48847811-48847833 CCGCCGCCGCCGCGGGGACCGAC 0: 1
1: 0
2: 5
3: 40
4: 376
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176226_954176240 16 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176225_954176240 19 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176222_954176240 26 Left 954176222 3:48847781-48847803 CCTGGCACCGCCGCCGCTGTCAC 0: 1
1: 0
2: 1
3: 36
4: 239
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176221_954176240 30 Left 954176221 3:48847777-48847799 CCGACCTGGCACCGCCGCCGCTG 0: 1
1: 0
2: 1
3: 11
4: 201
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176227_954176240 13 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176233_954176240 -7 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107
954176235_954176240 -10 Left 954176235 3:48847817-48847839 CCGCCGCGGGGACCGACGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 954176240 3:48847830-48847852 CGACGGGCAGGCGAGCTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176240 Original CRISPR CGACGGGCAGGCGAGCTGGA CGG Exonic