ID: 954176244

View in Genome Browser
Species Human (GRCh38)
Location 3:48847836-48847858
Sequence GCAGGCGAGCTGGACGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176235_954176244 -4 Left 954176235 3:48847817-48847839 CCGCCGCGGGGACCGACGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176227_954176244 19 Left 954176227 3:48847794-48847816 CCGCTGTCACTGGGCAGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176225_954176244 25 Left 954176225 3:48847788-48847810 CCGCCGCCGCTGTCACTGGGCAG 0: 1
1: 0
2: 3
3: 24
4: 198
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176237_954176244 -7 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176226_954176244 22 Left 954176226 3:48847791-48847813 CCGCCGCTGTCACTGGGCAGCCG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176233_954176244 -1 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211
954176231_954176244 2 Left 954176231 3:48847811-48847833 CCGCCGCCGCCGCGGGGACCGAC 0: 1
1: 0
2: 5
3: 40
4: 376
Right 954176244 3:48847836-48847858 GCAGGCGAGCTGGACGGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176244 Original CRISPR GCAGGCGAGCTGGACGGGCG GGG Exonic