ID: 954176246

View in Genome Browser
Species Human (GRCh38)
Location 3:48847848-48847870
Sequence GACGGGCGGGGCAGGCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176239_954176246 -4 Left 954176239 3:48847829-48847851 CCGACGGGCAGGCGAGCTGGACG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176233_954176246 11 Left 954176233 3:48847814-48847836 CCGCCGCCGCGGGGACCGACGGG 0: 1
1: 0
2: 1
3: 20
4: 113
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176231_954176246 14 Left 954176231 3:48847811-48847833 CCGCCGCCGCCGCGGGGACCGAC 0: 1
1: 0
2: 5
3: 40
4: 376
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176235_954176246 8 Left 954176235 3:48847817-48847839 CCGCCGCGGGGACCGACGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236
954176237_954176246 5 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176246 3:48847848-48847870 GACGGGCGGGGCAGGCGTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176246 Original CRISPR GACGGGCGGGGCAGGCGTCC TGG Intergenic