ID: 954176248

View in Genome Browser
Species Human (GRCh38)
Location 3:48847869-48847891
Sequence GGTTGTGACGCACGCCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176237_954176248 26 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176248 3:48847869-48847891 GGTTGTGACGCACGCCACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 19
954176239_954176248 17 Left 954176239 3:48847829-48847851 CCGACGGGCAGGCGAGCTGGACG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 954176248 3:48847869-48847891 GGTTGTGACGCACGCCACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 19
954176235_954176248 29 Left 954176235 3:48847817-48847839 CCGCCGCGGGGACCGACGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 954176248 3:48847869-48847891 GGTTGTGACGCACGCCACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176248 Original CRISPR GGTTGTGACGCACGCCACCG CGG Intergenic