ID: 954176249

View in Genome Browser
Species Human (GRCh38)
Location 3:48847870-48847892
Sequence GTTGTGACGCACGCCACCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954176237_954176249 27 Left 954176237 3:48847820-48847842 CCGCGGGGACCGACGGGCAGGCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 954176249 3:48847870-48847892 GTTGTGACGCACGCCACCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 14
954176235_954176249 30 Left 954176235 3:48847817-48847839 CCGCCGCGGGGACCGACGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 954176249 3:48847870-48847892 GTTGTGACGCACGCCACCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 14
954176239_954176249 18 Left 954176239 3:48847829-48847851 CCGACGGGCAGGCGAGCTGGACG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 954176249 3:48847870-48847892 GTTGTGACGCACGCCACCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954176249 Original CRISPR GTTGTGACGCACGCCACCGC GGG Intergenic