ID: 954178449

View in Genome Browser
Species Human (GRCh38)
Location 3:48862641-48862663
Sequence CTCCTGAAGAAGCCTGAATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954178447_954178449 1 Left 954178447 3:48862617-48862639 CCAAGGTACCAGTGTACTTGCTT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 954178449 3:48862641-48862663 CTCCTGAAGAAGCCTGAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 136
954178448_954178449 -7 Left 954178448 3:48862625-48862647 CCAGTGTACTTGCTTTCTCCTGA 0: 1
1: 0
2: 3
3: 20
4: 264
Right 954178449 3:48862641-48862663 CTCCTGAAGAAGCCTGAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 136
954178445_954178449 25 Left 954178445 3:48862593-48862615 CCTGGTACAGCTTCTTTGCACAG 0: 1
1: 1
2: 0
3: 19
4: 117
Right 954178449 3:48862641-48862663 CTCCTGAAGAAGCCTGAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954178449 Original CRISPR CTCCTGAAGAAGCCTGAATC TGG Exonic
902547690 1:17200147-17200169 CTCCTGAAGGTGCCTGAGTTTGG + Intergenic
902807223 1:18868682-18868704 CTCCTGGAGGAGTCTGAAGCTGG + Intronic
903530672 1:24027937-24027959 CTCCTGAAGAAGCTATAAGCGGG - Intergenic
904163397 1:28537391-28537413 GTCCTGTAGAAGCCTGGAGCTGG + Intronic
908261771 1:62344658-62344680 CTCCTGCAGAAGCATGCTTCTGG + Intergenic
909231360 1:73094219-73094241 CTTCTTAAGAAGCATAAATCAGG - Intergenic
911761931 1:101626813-101626835 CTCAGGAAGAAGCCTGATGCAGG + Intergenic
915660857 1:157403815-157403837 TCTCTGAAGAAGCCTGAAACAGG - Intergenic
915683492 1:157606219-157606241 CAGCTGAAGAAGCCTGCAGCAGG - Intergenic
916608197 1:166363746-166363768 ATCCTGAAGAACACTGAATTAGG + Intergenic
917700467 1:177575483-177575505 CGTGTGAAGAATCCTGAATCTGG - Intergenic
918108042 1:181429971-181429993 CTCCTGAAAAAGGCTGTGTCTGG - Intronic
918860453 1:189819509-189819531 CTCCTTTAAAAACCTGAATCAGG - Intergenic
919058364 1:192599225-192599247 CTCCTGCAGATGGATGAATCAGG + Intergenic
924132648 1:240927964-240927986 CTCCTGATTAACCCTGAGTCTGG + Intronic
1063367949 10:5502686-5502708 CTCCATAAGGAGCCTGAAGCTGG + Intergenic
1063480926 10:6375682-6375704 CTCCTGAAGAAGTCTCTTTCAGG - Intergenic
1070541559 10:77418871-77418893 CCCCTGGAGAAGTCTGAATGAGG - Intronic
1070641706 10:78175160-78175182 CACCTGGAGAACCCAGAATCTGG - Intergenic
1071917875 10:90316278-90316300 CACGTGAAAAAGCCTGAATTTGG + Intergenic
1072334503 10:94385485-94385507 CTCTTGAAGAAGCATGGGTCAGG + Intergenic
1075309978 10:121405822-121405844 CTCCTGGAGAAGGCTGGATGGGG - Intergenic
1076235147 10:128858279-128858301 CTGCTGAAGAAGCCAGGGTCAGG + Intergenic
1076809796 10:132880511-132880533 CTCCTGAGGAAGGCTGCCTCTGG + Intronic
1078036328 11:7809157-7809179 CACATGCAGAAGCCTGAAACTGG + Intergenic
1079763056 11:24355598-24355620 CTCTTGTACAAGCCTGAATCAGG + Intergenic
1083581413 11:63827600-63827622 CCCCTGCAGAGGCCTGAAGCTGG + Exonic
1085320427 11:75570669-75570691 ATCCTGAAGAATCCTGGACCCGG + Intronic
1087732881 11:101798405-101798427 CTCCTGAAGAAGAGGGCATCTGG + Intronic
1097739004 12:63216532-63216554 GTCCTTAGGAAACCTGAATCAGG + Intergenic
1098204502 12:68093770-68093792 ATCCTGAGGAAGCCAGAAACGGG + Intergenic
1098299355 12:69038079-69038101 ATCCTGAAGAACCCTCACTCAGG - Intergenic
1099005930 12:77234796-77234818 ATTGTGGAGAAGCCTGAATCTGG + Intergenic
1100026667 12:90137416-90137438 CTCATGAAGAAGAATGAAACTGG - Intergenic
1101547509 12:105730250-105730272 CTCTTGGAAAATCCTGAATCTGG + Intergenic
1101831796 12:108263620-108263642 CTCATGGAGCAGCCTGGATCTGG - Intergenic
1102037373 12:109779658-109779680 CTACTGAATGAGACTGAATCTGG + Intergenic
1102332155 12:112043499-112043521 CTCCTGCAGAAGCCATAAACTGG + Intronic
1107863912 13:44685088-44685110 CCCTTGAAGAAGCCAGACTCAGG + Intergenic
1109858041 13:68158949-68158971 CACCTGAAGAAACCTAAAACTGG - Intergenic
1112710507 13:102121930-102121952 CTGCTGAAGAAACCTTATTCTGG + Intronic
1113542661 13:111121240-111121262 CTCCTGCAGAAGTCTGTGTCTGG + Intronic
1119425990 14:74535081-74535103 CTCCTGAGGGAGTCTGACTCTGG + Intronic
1120743433 14:88132393-88132415 CCCCTGAAGAAGTCTAAATGTGG - Intergenic
1121129144 14:91429307-91429329 CTCCAGCAGGAGCCTCAATCTGG + Intergenic
1121551482 14:94805837-94805859 TTCCTAAAGAAGCCTGAAGTAGG + Intergenic
1123704415 15:22940609-22940631 CTCCTGAAAAGTCCTGAATTGGG - Intronic
1124400309 15:29342121-29342143 CTTCTGCAGCAGCCAGAATCAGG - Intronic
1125925824 15:43562313-43562335 ATGCTTAAGAAGCCAGAATCTGG - Intronic
1125938968 15:43661864-43661886 ATGCTTAAGAAGCCAGAATCTGG - Intronic
1126330194 15:47523338-47523360 CTGGTGAAGAAGCCAGAATTTGG - Intronic
1126748500 15:51851254-51851276 CTGCTGAAGAGTCATGAATCTGG - Intronic
1127450830 15:59114812-59114834 CTCCTGCAGAAGCCTAAACTTGG - Exonic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128722188 15:69958176-69958198 CTCTTTAAGAAGACAGAATCAGG + Intergenic
1128936333 15:71749444-71749466 CTCCTAGAGAATCCAGAATCTGG - Intronic
1129234491 15:74215757-74215779 CTACTGAAGAAGGCTGAGGCAGG + Intergenic
1130968173 15:88712254-88712276 CTCCTGAGGAAGGCTGTGTCTGG - Intergenic
1138229493 16:55326900-55326922 CTCCTGAAGAAGATTAAAGCAGG + Intronic
1141806359 16:86344340-86344362 TTCCTGGAGAAGCCTGCGTCTGG + Intergenic
1143287359 17:5800323-5800345 CACATGATGAAGCCTGCATCTGG + Intronic
1153556221 18:6316623-6316645 CTCTTGTGTAAGCCTGAATCTGG - Intronic
1163714890 19:18867867-18867889 CCCATGTAGAAGCCGGAATCTGG - Exonic
1166023403 19:40054943-40054965 CTCCCGAAAAATCCTGACTCTGG + Intronic
1166270217 19:41708880-41708902 CTCCTGTTGGAGCCTGAATAGGG + Intronic
1166499643 19:43331225-43331247 CTTCTGTTGAAGCCTGAATAGGG - Intergenic
926003475 2:9353151-9353173 CTCCTCAATCAGCCAGAATCAGG - Intronic
926753182 2:16215956-16215978 CTCTGGAAGAAGGCGGAATCGGG + Intergenic
932643233 2:73472926-73472948 CAGCTGTAGAAGCCTGAGTCTGG + Intronic
934168683 2:89320949-89320971 CAGCTGTTGAAGCCTGAATCAGG + Intergenic
934198607 2:89861634-89861656 CAGCTGTTGAAGCCTGAATCAGG - Intergenic
935053699 2:99546366-99546388 GTGCAGAAGAAGCCTGACTCAGG - Intronic
935899226 2:107772955-107772977 ACCCTGATGAAGCCTGAGTCCGG + Intergenic
937828369 2:126392516-126392538 CTTCTGAATAAGCCTGAGTATGG + Intergenic
938408522 2:131045815-131045837 CTCCTGCAGCAGCCTGAAGAGGG - Intronic
938939943 2:136161343-136161365 ATCCTGAAGAATCGTGCATCTGG - Intergenic
939623613 2:144449741-144449763 TTCCTGAAGAAAGCTGAATTTGG - Intronic
939835316 2:147123458-147123480 CTACTGAAAAAGCCTTAATATGG + Intergenic
941362052 2:164563360-164563382 TTCCTGATGAATCCTGATTCTGG + Intronic
944970097 2:204983075-204983097 CTCCTGAAAAATACTCAATCAGG - Intronic
945087619 2:206148763-206148785 CTTGTGAAGAAGGGTGAATCTGG - Intronic
945924656 2:215790827-215790849 CTCCTGAAGATGGCTGAGCCTGG + Intergenic
949072715 2:242035642-242035664 CTCCGGGAGAGGCCTGGATCTGG + Intergenic
1170865974 20:20158300-20158322 ATTGTGGAGAAGCCTGAATCTGG + Intronic
1173461772 20:43248697-43248719 CTCCTGATGAAGCCTGGGTCCGG + Intergenic
1173873314 20:46355072-46355094 CTCCTGCAGAAGGCTGAACTCGG - Exonic
1174241108 20:49135571-49135593 CTCCTGAAGCAGTCTGAAGATGG - Intronic
1175730915 20:61353312-61353334 TCCCTGAAGCAGCCTGTATCTGG + Intronic
1176587454 21:8602122-8602144 CTCCTGAGGAAGAGGGAATCTGG - Intergenic
1180270285 22:10579119-10579141 CTCCTGAGGAAGAGGGAATCTGG - Intergenic
1181621734 22:24095964-24095986 CTCCTGGGGAAGCCCGATTCTGG + Exonic
1182445845 22:30388821-30388843 CTCCTGAAGAAGTGTGAGACGGG + Intronic
949139905 3:619631-619653 CTCCTGAGGAAGAGGGAATCTGG + Intergenic
949195352 3:1299263-1299285 CTTCTGAAAAAGCCTGAAAATGG - Intronic
950671192 3:14526459-14526481 CTCATGAGGAAGCATTAATCAGG - Intronic
951858913 3:27228704-27228726 CTCTTGTGCAAGCCTGAATCTGG - Intronic
954178449 3:48862641-48862663 CTCCTGAAGAAGCCTGAATCTGG + Exonic
955756847 3:62233458-62233480 CTCCTGCAGAAGCCTGACAGAGG - Intronic
959117494 3:102195362-102195384 TTTCTGAAGCAGCCTGAAGCAGG - Intronic
959166597 3:102787518-102787540 TTCCTGAAGAAGAGTGAAGCAGG - Intergenic
962015010 3:131430773-131430795 CTCCATAAGAATCCCGAATCAGG + Intergenic
962144607 3:132827143-132827165 CACATGAAGAAGAATGAATCTGG + Intergenic
962494986 3:135930248-135930270 ATCCTGAATCATCCTGAATCTGG - Intergenic
966807502 3:183818553-183818575 CTCTTGAAGCAGCCTGGCTCTGG - Intronic
967180079 3:186895935-186895957 CTCCTGGGGCAGCCTGCATCTGG + Intergenic
967546121 3:190730746-190730768 TTCCTGATGAAGTCTTAATCAGG + Intergenic
967997405 3:195177082-195177104 CTCCTGTAGAAGCCTGAGGGAGG - Intronic
975970837 4:80034723-80034745 GGCCTGAAGAAGCCTTAAGCAGG - Intronic
983863984 4:172741286-172741308 CTGCTTAAGAAGCCGGAAGCTGG + Intronic
984335018 4:178379367-178379389 CTACTGAAGAAGGATGAATCAGG - Intergenic
987522431 5:19004324-19004346 CTCCTGAGGAAGTCTGACTATGG + Intergenic
989350577 5:40481277-40481299 CAAGTGAAGAAGTCTGAATCTGG - Intergenic
989707656 5:44356879-44356901 ATTCTGAAGAAGCCAGAATGAGG + Intronic
994639238 5:102386158-102386180 CTCCTGTAGACCCATGAATCAGG - Intronic
995124355 5:108565351-108565373 GTCCTGAAGAAGTCTGAAAATGG - Intergenic
995595943 5:113747934-113747956 ATCCTGAAGAAGGCAGAATGTGG + Intergenic
998102677 5:139447310-139447332 CACCTTGAGAAGTCTGAATCAGG + Intergenic
1000413553 5:160959567-160959589 TACCTGAAGAAGCCAGGATCTGG - Intergenic
1002164940 5:177338308-177338330 CTCCGGAAGGAGCCTGGCTCTGG - Intronic
1002695016 5:181081489-181081511 CTACTGGAGAAACCTGAGTCAGG - Intergenic
1005841073 6:29744906-29744928 CTCCTATAGAAGCCTGAACCTGG - Intergenic
1006474246 6:34244714-34244736 CTCCTGAAGAGGGATGAGTCAGG - Intronic
1007483524 6:42165371-42165393 CTCCAGAAGAACCTTCAATCAGG + Intronic
1019019454 6:168905622-168905644 CTCCTAAAGCAGCCTGTGTCAGG + Intergenic
1020412624 7:7909936-7909958 CTCCTGAAGAAGCCTAAACTTGG + Intronic
1032352333 7:131176596-131176618 CTGCTGAAGAAGGATGAATGTGG - Intronic
1033821080 7:145134636-145134658 CTCCTGGAGTAGCCTGAATAGGG - Intergenic
1036781625 8:11651754-11651776 CTACTGGAGAAGCCTAACTCTGG - Intergenic
1038930313 8:32186843-32186865 CTCCAGAAGTAGCCTAAATAGGG - Intronic
1040362722 8:46683160-46683182 CTCTTGTGCAAGCCTGAATCTGG + Intergenic
1041095026 8:54341606-54341628 CTCCTGGAGAAGCTGGATTCTGG + Intergenic
1045041707 8:98230735-98230757 CTTCAGAAGGAGCCTGATTCTGG - Intronic
1048366912 8:133746143-133746165 ACCCTGAAGGAGCCTGAAGCTGG - Intergenic
1053030106 9:34768262-34768284 CTGTTTAAGAAGCTTGAATCTGG + Intergenic
1054854098 9:69879453-69879475 CTCCTGAATATGCATGATTCAGG - Intronic
1058643264 9:107107479-107107501 CACCTGCAGAAGACTGAATGGGG + Intergenic
1060663570 9:125419136-125419158 CTCCAAAAGAAGCCAGACTCAGG - Intergenic
1203617416 Un_KI270749v1:80304-80326 CTCCTGAGGAAGAGGGAATCTGG - Intergenic
1187493614 X:19775741-19775763 CTCATTAAGAAGCATGAATAGGG - Intronic
1188870552 X:35365689-35365711 CTCTTGTGGAAGCCTGAACCTGG - Intergenic
1192047852 X:67695347-67695369 CTCCTGGAGAAGCAGAAATCTGG - Intronic
1198467933 X:136920407-136920429 CGCCTGAGGAAGCCTGAGGCAGG - Intergenic
1200073292 X:153539317-153539339 CTCCTGAAGAAACCTGAGCCAGG + Intronic
1202039182 Y:20664888-20664910 TTCCTGAAGCAGCCTGAAAAAGG - Intergenic