ID: 954188125

View in Genome Browser
Species Human (GRCh38)
Location 3:48935844-48935866
Sequence AGGAGCCTACACATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954188120_954188125 21 Left 954188120 3:48935800-48935822 CCTTAAAACACATTCTCAGGGTT 0: 1
1: 0
2: 0
3: 20
4: 167
Right 954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG 0: 1
1: 0
2: 0
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954188125 Original CRISPR AGGAGCCTACACATTGAGGA TGG Intronic
900558904 1:3294021-3294043 AGGAGCCGCCACAGTGAGGCAGG - Intronic
902373326 1:16018432-16018454 AGGAGCCTGCACACTGATGGAGG - Exonic
906578926 1:46918128-46918150 ACGAGCCTCCTCATTGAGAAAGG + Intergenic
906594410 1:47062408-47062430 ACGAGCCTCCTCATTGAGAAAGG - Intergenic
908013544 1:59808498-59808520 AGAAGCCTCCAAAATGAGGAAGG - Intergenic
908241816 1:62194868-62194890 AGGAGCGAACAAAGTGAGGATGG - Exonic
908447155 1:64210333-64210355 TGGAATCTTCACATTGAGGATGG - Intronic
908640380 1:66216284-66216306 AGGCCCATGCACATTGAGGAGGG - Intronic
910730959 1:90395460-90395482 AGAAGCCTATACTTTGAGGGTGG - Intergenic
912634264 1:111277296-111277318 AGGAGCCCACACAATAAGGTTGG + Intergenic
913030210 1:114894355-114894377 AGGACCCTTAACAGTGAGGAAGG + Intronic
913488529 1:119356507-119356529 AGGAGCCTGCATGCTGAGGATGG - Intergenic
916279150 1:163029483-163029505 AGGAGTCTACAGATTTAGGTAGG - Intergenic
916455439 1:164966285-164966307 AAAAGCCAACACGTTGAGGATGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919922662 1:202175722-202175744 AGGAGCCACCACATTGGAGAGGG - Intergenic
920657478 1:207887576-207887598 GGGGCCCTACACCTTGAGGAGGG - Exonic
923114104 1:230918214-230918236 AATAGCATACACATTGAGTAAGG + Intronic
924211954 1:241778185-241778207 AGGGACATACACATTAAGGATGG + Intronic
924547331 1:245041856-245041878 TGGCGCCTACAAATTGAGGAAGG + Intronic
1064872303 10:19951983-19952005 AGGAGACTACACGGTGAGGGGGG + Intronic
1067234406 10:44436047-44436069 ATGAGGCTACTCATTGAGAAAGG - Intergenic
1067757298 10:49014878-49014900 GGCTGCCTGCACATTGAGGAGGG - Exonic
1068012762 10:51475162-51475184 AGGAGTCCACACATAGAGGTAGG - Intronic
1070523184 10:77272312-77272334 AGGAACCTATACTTTAAGGAGGG - Intronic
1070546708 10:77458245-77458267 AGAAGCCAGCACAGTGAGGAGGG - Intronic
1070587995 10:77780716-77780738 TGGAGCCTCCACAGTGATGATGG - Intergenic
1070878578 10:79839662-79839684 AAGAGCCTTCACATTGATGCAGG + Intergenic
1070961301 10:80502026-80502048 AGGAGGTCACACATGGAGGATGG + Intronic
1071645136 10:87355972-87355994 AAGAGCCTTCACATTGATGCAGG + Intergenic
1072211463 10:93250359-93250381 AGGACCAAAGACATTGAGGATGG + Intergenic
1077553284 11:3213638-3213660 AGGAGCCTTCACAGAGGGGAAGG - Intergenic
1080340417 11:31256939-31256961 AGCAGCCTACACAGTAAGGAAGG - Intronic
1083281357 11:61629075-61629097 AGGGGCCTCCACAGTGGGGAAGG + Intergenic
1085272403 11:75278125-75278147 GGGTGCCCACACCTTGAGGAGGG + Intronic
1087084435 11:94202241-94202263 AGCAGCCTACACAGTGATTATGG + Intergenic
1087934436 11:104016267-104016289 AGCAGCCAACACATTCAGGATGG - Intronic
1088354218 11:108925194-108925216 AGGTTGCTACACATTGGGGAAGG + Intronic
1090022581 11:123140893-123140915 AGGAGCCAAGACATTCATGAGGG - Intronic
1095714987 12:45334401-45334423 AAGAGCCAAAATATTGAGGATGG - Intronic
1098863314 12:75733649-75733671 ATGGGCCTAAACATTGAGAAAGG - Intergenic
1099520730 12:83658138-83658160 AGGAGATTACACAATGAGGCAGG - Intergenic
1099791027 12:87333675-87333697 AGGAGCCTATACATTGCAAAAGG - Intergenic
1100514922 12:95318117-95318139 AGGAATTTAAACATTGAGGATGG - Intergenic
1104704979 12:130937188-130937210 AAGATCCAATACATTGAGGAAGG - Intergenic
1104787342 12:131457986-131458008 AGGAGCCTACAGGTGGAGGGGGG - Intergenic
1104925607 12:132312666-132312688 AGGAACCCACACACGGAGGATGG + Intronic
1105262678 13:18791526-18791548 TGGTGCCTAAACATTGATGAAGG + Intergenic
1107660650 13:42635939-42635961 ATAAGCCTACACATGGAGGAAGG + Intergenic
1111738385 13:92171396-92171418 AGGAGATTATACATTTAGGAAGG - Intronic
1111793209 13:92884932-92884954 AGGATCCAACACACTGATGATGG - Intergenic
1112921525 13:104618655-104618677 AGGAGCAAATACAATGAGGAAGG - Intergenic
1114233256 14:20802575-20802597 AGGAGCCTCCAAATTGGGGGAGG - Intronic
1119062356 14:71487977-71487999 TGGCACCTACACACTGAGGATGG - Intronic
1121519577 14:94576892-94576914 AGGAGGAGACACATTAAGGAAGG - Intronic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1123017360 14:105381815-105381837 AGTGGCCTACACATTGTGGTGGG - Intronic
1125404169 15:39335562-39335584 AGGTGCCTTAACATTTAGGAAGG - Intergenic
1129013723 15:72446805-72446827 AAGAGCCAACATACTGAGGATGG + Intergenic
1130798957 15:87240957-87240979 TGGAGCCTTCACAGAGAGGATGG + Intergenic
1131919436 15:97307901-97307923 AAGTGCCTAAACATTAAGGATGG + Intergenic
1132834639 16:1946689-1946711 AGGGGCCCGCACATGGAGGACGG - Exonic
1132841995 16:1982590-1982612 AGGAGCATACAGATGGAGGGTGG - Exonic
1133467483 16:6041804-6041826 TGGAAACTACACACTGAGGAAGG - Intronic
1133916276 16:10112513-10112535 TGGAGCCTCCACAGTGATGATGG + Intronic
1139484819 16:67249442-67249464 AGGAGCCTACAGATGGAGTTGGG - Intronic
1145812604 17:27773446-27773468 TGGAGCCTGCACATCGAGGGGGG + Intronic
1148063079 17:44849850-44849872 AGGAGCCTAAACAGGGAAGATGG - Intronic
1154426022 18:14272597-14272619 TGGTGCTTAAACATTGAGGAAGG - Intergenic
1156504217 18:37578566-37578588 AGGTGCATAGACACTGAGGACGG + Intergenic
1157052447 18:44182483-44182505 AGGAGACTAGACATTGGAGAGGG + Intergenic
1157334518 18:46728376-46728398 AGGAGCCCACACACTGTGAATGG - Intronic
1157888511 18:51392114-51392136 AGAAGTCAACACACTGAGGATGG + Intergenic
1162095180 19:8306041-8306063 AGGAGCTGACACATTTAGGATGG - Intronic
1163071464 19:14845590-14845612 AGGAGCTACCACATTGAGTAGGG + Intergenic
1164461831 19:28455544-28455566 AGGAGACTAAATATTGAGAAAGG - Intergenic
1164604999 19:29591545-29591567 AGCAGCCTCCACATCCAGGAGGG + Intergenic
1164831649 19:31326561-31326583 CGGAGCCTGCACAGTGAGGGTGG + Intronic
1166500512 19:43337670-43337692 AGGAGCCCACACAAGGTGGAAGG + Intergenic
1167618481 19:50548835-50548857 CGGAGCATGAACATTGAGGATGG - Exonic
925561898 2:5205011-5205033 AAAAGCCCAAACATTGAGGAAGG + Intergenic
925993099 2:9269518-9269540 AGGAGCCCCCACATGGAGGAGGG + Intronic
926158583 2:10472311-10472333 AGAAGCCTAGAGATGGAGGAAGG - Intergenic
929424538 2:41830581-41830603 AGGAGCCTGCACAGTGAGAGGGG - Intergenic
939308184 2:140435590-140435612 AGGAGCCTACACAATGAGTCAGG - Intronic
942405531 2:175650005-175650027 AGGTGCATATACATTTAGGATGG - Intergenic
943369749 2:187002260-187002282 TGGAGCCTCCACAGTGATGATGG - Intergenic
944581742 2:201137902-201137924 AGGAGCCTCCACAGTGATGATGG - Intronic
946774223 2:223120713-223120735 AGGAGCCTACACAGTGTTGATGG - Intronic
947542428 2:230988193-230988215 AGGAAGCCACATATTGAGGATGG + Intergenic
948219520 2:236258482-236258504 AAGAGCGTACCCATTGATGATGG - Intronic
1168993303 20:2113162-2113184 AGGTGCCTGTGCATTGAGGAAGG - Intronic
1169002179 20:2176138-2176160 AGAGGCCCACACACTGAGGATGG + Intronic
1170445156 20:16418860-16418882 AGAAGCAGACACATTGAGGGAGG - Intronic
1170713165 20:18810124-18810146 AAAAGGCAACACATTGAGGATGG + Intronic
1172289630 20:33766799-33766821 AGGAGCCGGCCCATTCAGGAAGG - Intronic
1173901035 20:46589015-46589037 GGGAGCCTAGAGATGGAGGATGG - Intronic
1174005192 20:47405045-47405067 AAAAGCCGACACACTGAGGATGG - Intergenic
1174418440 20:50383472-50383494 GGAAGCCCACACACTGAGGATGG - Intergenic
1175769132 20:61611862-61611884 AGGAGCCTCCAGATTCAGGCAGG - Intronic
1176106216 20:63389710-63389732 AGCTGACTACACATTTAGGATGG - Intergenic
1176327990 21:5519044-5519066 GGGAGCCTACAGTCTGAGGACGG - Intergenic
1176399767 21:6301907-6301929 GGGAGCCTACAGTCTGAGGACGG + Intergenic
1176437390 21:6687197-6687219 GGGAGCCTACAGTCTGAGGACGG - Intergenic
1176461652 21:7014267-7014289 GGGAGCCTACAGTCTGAGGACGG - Intergenic
1176485213 21:7396045-7396067 GGGAGCCTACAGTCTGAGGACGG - Intergenic
1176846006 21:13877242-13877264 TGGTGCTTAAACATTGAGGAAGG + Intergenic
1180748276 22:18107249-18107271 AGGCCCCTGCACATTAAGGAGGG + Intronic
1182778328 22:32847647-32847669 TGGAGCATCCACAATGAGGAAGG + Intronic
1183218367 22:36495928-36495950 AGGAGCCCACAGGTTGGGGAAGG + Intronic
1184321247 22:43743781-43743803 AGAAGCCTAGAGATGGAGGAAGG + Intronic
1185110002 22:48895502-48895524 AGGAGCCTGGACATCCAGGAGGG + Intergenic
950528054 3:13536142-13536164 AGGGGCCCAGACATTGAGAAGGG + Intergenic
950831404 3:15879166-15879188 TGGAGCCTCCACAGTGATGACGG + Intergenic
951940344 3:28071119-28071141 AGCAGTCTAAACATTGAAGACGG - Intergenic
952114025 3:30158158-30158180 AGGTGATGACACATTGAGGATGG + Intergenic
953389086 3:42524234-42524256 AAGAGCCTACCCTTTGATGAGGG + Intronic
954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG + Intronic
954608161 3:51929593-51929615 AGGAAGCTCCACATTGGGGAAGG + Intergenic
955089589 3:55736298-55736320 TGGAGCCTAATGATTGAGGAAGG - Intronic
955264535 3:57428765-57428787 TGGAGCCTTCACAGTTAGGATGG - Intronic
955715024 3:61820412-61820434 TGGTGCCCACCCATTGAGGAAGG + Intronic
960724095 3:120653050-120653072 AGGAGCCCACACAGGGAGGCTGG - Intronic
962986608 3:140541859-140541881 AGAAGCCTAAACCATGAGGAGGG - Intronic
965240594 3:166192085-166192107 AGGAGCCTTTCCATTGAGGTTGG - Intergenic
965379053 3:167965639-167965661 AGGCCCACACACATTGAGGATGG - Intergenic
966685516 3:182690247-182690269 TGGAGACTACACTTTGAGAACGG - Intergenic
967871271 3:194231892-194231914 AGCAGCCTCCACACTGAGGGAGG - Intergenic
968288625 3:197522516-197522538 AAGAGCCTAAACAATAAGGAAGG + Intronic
972814589 4:42629952-42629974 ATGAACCAACACTTTGAGGAAGG + Intronic
973729898 4:53813192-53813214 GGGAAGCCACACATTGAGGAGGG - Intronic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
977415454 4:96727195-96727217 AGGCCCATACACATTGAGGAGGG - Intergenic
978201152 4:106024712-106024734 AGGAGACTACACATTGGGTATGG - Intergenic
980413345 4:132452138-132452160 AGGAACCTACAGATTCAGTACGG + Intergenic
980894767 4:138851517-138851539 AGGAAACTTCACATTGAGAATGG + Intergenic
981171688 4:141632637-141632659 TGGTGCCTACACATTAAGGGTGG - Intergenic
982552496 4:156820428-156820450 AGCAGCCACCACATTGAGGCAGG + Intronic
986841711 5:11705239-11705261 AGGATGCTACACATTGTGTATGG + Intronic
987539282 5:19233325-19233347 GGGAGCATGCACATTGAGGCAGG - Intergenic
991053579 5:62298323-62298345 ATCAGACTACACATGGAGGAAGG + Intergenic
993940826 5:94056935-94056957 AGGCTCATACAAATTGAGGAGGG - Intronic
997270055 5:132528922-132528944 AGCATCATACACATTTAGGAGGG - Intergenic
997934329 5:138097360-138097382 AGCAGGCTACACCTGGAGGAAGG - Intergenic
998896866 5:146809400-146809422 AGCAGCCAACCCAATGAGGAAGG + Intronic
999434479 5:151552772-151552794 TGGAGCCAAAACATTGAGCATGG + Intronic
1000467789 5:161601188-161601210 AGGAGCCACCACAAGGAGGAGGG - Intronic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1002829838 6:809702-809724 AGGAGCCCACACAGTAAGGATGG - Intergenic
1004475180 6:15964950-15964972 AGAAGCCTCCATATTGATGAAGG - Intergenic
1004560686 6:16747044-16747066 AGGACCCTACAGAGTGAGTATGG - Intronic
1004732007 6:18367441-18367463 TGGAGCCTCCACAGTGATGATGG - Intergenic
1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG + Intergenic
1005844939 6:29769845-29769867 AGGAGACTGTACATTGGGGAAGG + Intergenic
1007085864 6:39144680-39144702 AGTAGCCCACACACTGAGAAGGG - Intergenic
1007125560 6:39422961-39422983 ATGAGGCTGCACCTTGAGGAGGG + Intronic
1008141372 6:47836312-47836334 TGGATGCTACACATTGAGAATGG - Intergenic
1008456959 6:51722167-51722189 AGGACCCTCCACACTGAGGGCGG - Intronic
1010161488 6:72861932-72861954 AGGAGCAGACACAGTGAGAAGGG - Intronic
1011070983 6:83382954-83382976 AGGCCCATACACATTGTGGAAGG - Intronic
1011373262 6:86663413-86663435 AGGTGCCTATATATTTAGGATGG + Intergenic
1012818088 6:104049888-104049910 AAGAGACTACACATTGGGTACGG + Intergenic
1013168558 6:107616057-107616079 GGATGCCTACTCATTGAGGAAGG + Intronic
1018471510 6:164101591-164101613 AGGAGCCTGCAGGTGGAGGAGGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1025252538 7:57361394-57361416 AGAAGCCCACACACTGAGGTTGG + Intergenic
1026012672 7:66648928-66648950 ACCAGCCTACACATTGGGGTGGG + Intronic
1026110527 7:67455500-67455522 AGGGGCTAACACATTGAGCAAGG - Intergenic
1030536391 7:110772212-110772234 TGGAGTCTACACATTGAGAATGG + Intronic
1032591372 7:133194819-133194841 TGGTGCACACACATTGAGGATGG - Intergenic
1033097155 7:138441836-138441858 TGGAGCCTCCACAGTGATGATGG + Intergenic
1036225358 8:6953350-6953372 ACCAACCTACACACTGAGGAGGG + Intergenic
1038471932 8:27831375-27831397 AGGTACATACACATTTAGGATGG - Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1042354365 8:67810060-67810082 AGGAGCCTGGACTCTGAGGAAGG - Intergenic
1043626309 8:82264193-82264215 ACGTGCTTACACATTAAGGATGG + Intergenic
1045160539 8:99537848-99537870 ATGACCCTACACATTAAGGAAGG - Intronic
1046724259 8:117657139-117657161 ATCAGCATAAACATTGAGGATGG - Intergenic
1048715062 8:137259306-137259328 ATGAGGCTATAAATTGAGGATGG + Intergenic
1056511588 9:87311111-87311133 AGGAACCCAGACATTGAAGAAGG + Intergenic
1059642641 9:116232651-116232673 CAGTGCCTGCACATTGAGGATGG + Intronic
1062627178 9:137448568-137448590 TGGAGCCTCCACACTGAGGCTGG + Exonic
1186689879 X:11964039-11964061 AGCTGCCTACACATAGAGGTGGG + Intergenic
1187364457 X:18655114-18655136 AAGAGCTCACACACTGAGGAGGG - Intronic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1189292690 X:39897139-39897161 AGAAGCCTAGACATTGAGGGAGG - Intergenic
1189361912 X:40359569-40359591 TGGAGCCTCCACAGTGATGATGG - Intergenic
1189659117 X:43278505-43278527 TGGAGCCTCCACAGTGATGACGG - Intergenic
1190634350 X:52419625-52419647 AGGAGCATGCACATTGAGTCAGG - Intergenic
1195452820 X:105034841-105034863 TGGAGCCTACAGAATCAGGAAGG + Intronic
1195793026 X:108610247-108610269 AGGAGCCAAAACATTGACGAGGG - Intronic
1198119949 X:133582466-133582488 AGTAGCCCACACATTGAGTAGGG - Intronic
1198494443 X:137177299-137177321 AGAAGCCAACACATTAAGGGTGG + Intergenic
1199794255 X:151179550-151179572 AGGAGCCTTCACAATGAGACAGG - Intronic
1200147029 X:153931654-153931676 AGGAGAATGCACATTCAGGAAGG - Intronic
1201890053 Y:18933352-18933374 AGAAACCTACACATTGGGGTAGG - Intergenic