ID: 954190661

View in Genome Browser
Species Human (GRCh38)
Location 3:48958041-48958063
Sequence AGGGGTAAACTGACGTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954190652_954190661 19 Left 954190652 3:48957999-48958021 CCACTGCGCCTGGCCCCACTTCA 0: 2
1: 5
2: 105
3: 852
4: 4594
Right 954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG 0: 1
1: 1
2: 1
3: 14
4: 92
954190654_954190661 6 Left 954190654 3:48958012-48958034 CCCCACTTCATGTTTTTTAAAAC 0: 1
1: 0
2: 9
3: 45
4: 598
Right 954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG 0: 1
1: 1
2: 1
3: 14
4: 92
954190656_954190661 4 Left 954190656 3:48958014-48958036 CCACTTCATGTTTTTTAAAACTA 0: 1
1: 2
2: 5
3: 91
4: 685
Right 954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG 0: 1
1: 1
2: 1
3: 14
4: 92
954190655_954190661 5 Left 954190655 3:48958013-48958035 CCCACTTCATGTTTTTTAAAACT 0: 1
1: 0
2: 4
3: 83
4: 818
Right 954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG 0: 1
1: 1
2: 1
3: 14
4: 92
954190653_954190661 11 Left 954190653 3:48958007-48958029 CCTGGCCCCACTTCATGTTTTTT 0: 1
1: 1
2: 12
3: 180
4: 2045
Right 954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG 0: 1
1: 1
2: 1
3: 14
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954190661 Original CRISPR AGGGGTAAACTGACGTAGGT TGG Intronic
900434093 1:2619220-2619242 TGGGGTCATCTGACCTAGGTTGG - Intronic
902962090 1:19971145-19971167 AGGGGTGAACTGGCCAAGGTTGG + Intergenic
905709833 1:40092237-40092259 AGAGGTAAACTCATTTAGGTTGG + Intronic
906786896 1:48623874-48623896 TGGGGTAAACTGGAGTAGTTTGG + Intronic
908541401 1:65126053-65126075 AGGGGTAGACTGGCCCAGGTTGG + Intergenic
913293637 1:117298169-117298191 AGAGGTAAACTGAAGAGGGTAGG - Intergenic
914849050 1:151300766-151300788 AGGGGTGAACTGGCCCAGGTCGG - Intronic
915192829 1:154166349-154166371 AGGGGTGAACTGGCCCAGGTCGG - Intronic
915626465 1:157117154-157117176 AAGGGGAAACTGAGGTATGTAGG - Intergenic
917700706 1:177577926-177577948 TGGGATCAACTGACCTAGGTAGG + Intergenic
1062807135 10:430334-430356 AGGGGTGAACTAGCTTAGGTTGG - Intronic
1069397668 10:68007820-68007842 AGGGGTGAACTGGCTCAGGTTGG - Intronic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1075847511 10:125556583-125556605 GGGGGTAAACTGAGGAAGCTGGG + Intergenic
1077640388 11:3876291-3876313 ATGGATAAACAGACCTAGGTAGG + Intronic
1077747665 11:4925177-4925199 AGAGGTAAAGTGACCTGGGTAGG + Intronic
1078246836 11:9581096-9581118 AGGGGTAAACTGGCCTAAGTTGG + Intronic
1078961852 11:16284730-16284752 AGGGGTAGACTGACATACGTGGG - Intronic
1080782279 11:35440729-35440751 AGGGGTAAACTTAAATATGTAGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1086864989 11:91970214-91970236 AGGGATAAAGTGAGGTAGGCAGG - Intergenic
1089757775 11:120699030-120699052 AGGGGCAAACAGACACAGGTGGG - Intronic
1095569229 12:43664177-43664199 AGGGGCAAACTGAGGTGGGTGGG - Intergenic
1097830432 12:64218724-64218746 AGGGGTAATCTGATGAAGTTAGG - Intronic
1098041362 12:66356712-66356734 AGGTGTATACTGAAGTATGTAGG - Intronic
1098578304 12:72069863-72069885 AGGGGTAAAATGACATGGTTTGG - Intronic
1102039066 12:109789075-109789097 AGGGGTGAACTGTCCCAGGTTGG - Intronic
1105694986 13:22879223-22879245 AGGGGTGAACTGGCCTAGGTCGG - Intergenic
1108556070 13:51594020-51594042 AGGGGTAAACTGGCCCAAGTCGG - Intronic
1108733454 13:53258252-53258274 AGGGGTGAACTGGCCCAGGTGGG + Intergenic
1109713056 13:66183975-66183997 AGGGATAAAATGAAGTTGGTTGG - Intergenic
1111949459 13:94699324-94699346 AGGGGTGAACTGGCACAGGTTGG - Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116714058 14:48406310-48406332 AGGGGAAAAATGATATAGGTTGG - Intergenic
1119058513 14:71448850-71448872 AGGGGTCAACTGGCCCAGGTTGG + Intronic
1130929914 15:88416836-88416858 AGCAGTAAACTGACCTAGTTGGG - Intergenic
1131254965 15:90856035-90856057 AAGGGTAAACTGGCTCAGGTAGG - Intergenic
1131853928 15:96571852-96571874 AGGGGTCAGCTGATGTAGGATGG - Intergenic
1133360866 16:5172830-5172852 AGGGGTAAACAGATGTGGGTAGG - Intergenic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1139256138 16:65544471-65544493 AGGGGAAAACTGAAAAAGGTTGG + Intergenic
1148874678 17:50679925-50679947 AGGGGGAATCTGAAGTAGCTGGG + Intronic
1149098251 17:52871034-52871056 AGGGGGAAAGTGACCTAGGTAGG - Intronic
1152701296 17:81821195-81821217 AGGGGTAAATTGAGGCAGGCTGG + Intergenic
1153925299 18:9830431-9830453 AGGGGTGAACTGGCCCAGGTAGG - Intronic
1157214894 18:45774641-45774663 ATGGGAAGACTGACATAGGTGGG - Intergenic
1165175594 19:33927452-33927474 AGGGGTGAACTGGCCCAGGTTGG - Intergenic
1165717626 19:38056512-38056534 AGGGGTAAACTGACGAAGGATGG - Intronic
933450390 2:82442003-82442025 AGGGTTACACTGAAGTAGGGAGG - Intergenic
948121303 2:235532756-235532778 AAGGGTAAGCTGAGGCAGGTAGG - Intronic
1168831722 20:848663-848685 AAGGGTAAACTGAGGTCTGTGGG - Intronic
1168880973 20:1205687-1205709 AGGGATAAAGTGAGGTGGGTGGG + Intronic
1171410450 20:24943554-24943576 AGGGGGAAACTGAGGTTGGGAGG + Intergenic
1173030407 20:39352923-39352945 AGGGGTGAACTGACCCGGGTTGG + Intergenic
1173133835 20:40421649-40421671 AGGGGTTAACTGACCTAGGCTGG - Intergenic
1173561284 20:44007422-44007444 AGGGGTAAACTGGCCACGGTCGG + Intronic
1173680892 20:44880937-44880959 AGGGGTAAACTGGCCAAGGTTGG - Intergenic
1178408190 21:32342595-32342617 AGAGGTGAACTGGCCTAGGTTGG - Intronic
1182549392 22:31092775-31092797 ATGGGTAAACTGAGGCAAGTTGG - Intronic
1182967412 22:34535231-34535253 AGGGGTAAAAAGATGTAGCTCGG - Intergenic
1183600626 22:38838229-38838251 AGGGGAAAACTGAAGCTGGTGGG + Intronic
1183661417 22:39223829-39223851 AGGGGGAAAGTGCAGTAGGTGGG + Exonic
950494309 3:13324485-13324507 AGGGGCACACAGAGGTAGGTAGG - Intronic
951365611 3:21778350-21778372 AGGGATAAAATGAAGTAGTTGGG - Intronic
952073410 3:29667362-29667384 AGGGGTATACTGACGTTGTTTGG - Intronic
954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG + Intronic
954867391 3:53741511-53741533 AGGGGTAAACAGTTGTTGGTTGG - Intronic
955203131 3:56869711-56869733 AGGGGTAAACTCAATTAGCTGGG + Intronic
956003592 3:64754657-64754679 AGAGATAAACTGAAGTTGGTAGG + Intergenic
956077147 3:65517529-65517551 AGGGGAAAACTGAAGAAAGTGGG + Intronic
956158561 3:66324029-66324051 AGGGGTGAACTGGCCCAGGTTGG + Intronic
958558093 3:95705436-95705458 AGGGGAAAAATGACATAGTTTGG + Intergenic
961824423 3:129591525-129591547 AGGGGTGAACTGGCCCAGGTCGG + Intronic
964122438 3:153199800-153199822 AGGGGTGAACTGGCCCAGGTCGG - Intergenic
968158104 3:196400087-196400109 AGGGGTGAACTGGCCCAGGTTGG + Intronic
971661641 4:29425127-29425149 AGGGTAAAACAGAAGTAGGTAGG + Intergenic
973695442 4:53486187-53486209 AGGGGTGAACTGGCGCAGGGCGG - Intronic
981104870 4:140868983-140869005 AAGGGTACACTGAGGTAGGTAGG + Intronic
985748614 5:1661808-1661830 AGAAGTAAAATGACGTAGGTGGG - Intergenic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
991719059 5:69479084-69479106 AGGGGTGAACTGGCCCAGGTTGG - Intergenic
996396920 5:123022588-123022610 AGGGGTGAACTGGCCCAGGTTGG - Intronic
997417827 5:133742560-133742582 AGCAGTATACTGACGTATGTGGG + Intergenic
997520129 5:134517977-134517999 AGGGGTGAACTGACCCAGGTCGG + Intergenic
998347790 5:141479502-141479524 AGGGGTGAACTGGCCCAGGTTGG + Intronic
999012397 5:148056895-148056917 AGGGGTAGAATGATGTAGTTTGG + Intronic
999763163 5:154718492-154718514 AGGGGTGAACTGGCCCAGGTTGG - Intronic
1002015730 5:176320673-176320695 AGGGGTAAATTGAAATATGTAGG - Intronic
1006353694 6:33540879-33540901 AGGGGTGAACTGGCCCAGGTAGG + Intergenic
1006883664 6:37361360-37361382 AGAGGTGAACTGACCCAGGTTGG + Intronic
1015787429 6:136932232-136932254 AGGGGTAAACTGAAGTATGGAGG + Intergenic
1017548246 6:155475005-155475027 AGGGGTAAGAGGAAGTAGGTAGG + Intergenic
1019089552 6:169517001-169517023 AGGGGTAGAATGATGTAGTTTGG + Intronic
1023626603 7:42121140-42121162 AGGGGAACACTGAGGCAGGTGGG - Intronic
1025090958 7:56064157-56064179 AGGGGGAAACTGACGGAGCGAGG - Intronic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1029984670 7:104912083-104912105 AGGGGTGAACCGACCCAGGTCGG + Intergenic
1033922852 7:146416361-146416383 AGAGGCAAACTGACCCAGGTCGG - Intronic
1034099478 7:148438462-148438484 AGGGGTGAACTGACCCAGGTTGG + Intergenic
1046933331 8:119862837-119862859 AGGGGTGAACTGGCCCAGGTCGG + Intergenic
1051867701 9:21699469-21699491 AGGGGTGAACTGGCCCAGGTCGG + Intergenic
1053063476 9:35049440-35049462 AGGGGTGAACTGGCCCAGGTGGG + Intergenic
1059852195 9:118354908-118354930 TGGGCTAAAATGATGTAGGTTGG - Intergenic
1060175521 9:121494698-121494720 AGGGGTAAACTGACTTAGGTTGG + Intergenic
1061240708 9:129370271-129370293 AGGGGTGAACTGGCCCAGGTTGG - Intergenic
1187008758 X:15258119-15258141 TGGGGTGGACTGACCTAGGTAGG + Intronic
1192336197 X:70222107-70222129 AGGGGTGAACTGAGCCAGGTTGG - Intergenic
1192570381 X:72198927-72198949 AGGGGTGAACTGGCCCAGGTTGG + Intronic
1196601686 X:117607899-117607921 TGGGGTACACTGAAGTAGGATGG + Intergenic