ID: 954192608

View in Genome Browser
Species Human (GRCh38)
Location 3:48974716-48974738
Sequence CACCATGAGCAACTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954192602_954192608 -5 Left 954192602 3:48974698-48974720 CCTCCCCAGAAGTGCTCACACCA 0: 1
1: 0
2: 0
3: 25
4: 182
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192601_954192608 15 Left 954192601 3:48974678-48974700 CCACATTTAAGTGAGGTGCTCCT 0: 1
1: 0
2: 1
3: 19
4: 131
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192603_954192608 -8 Left 954192603 3:48974701-48974723 CCCCAGAAGTGCTCACACCATGA 0: 1
1: 0
2: 0
3: 10
4: 113
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192598_954192608 28 Left 954192598 3:48974665-48974687 CCTCAGCGACCTGCCACATTTAA 0: 1
1: 0
2: 0
3: 26
4: 274
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192605_954192608 -10 Left 954192605 3:48974703-48974725 CCAGAAGTGCTCACACCATGAGC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192600_954192608 19 Left 954192600 3:48974674-48974696 CCTGCCACATTTAAGTGAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207
954192604_954192608 -9 Left 954192604 3:48974702-48974724 CCCAGAAGTGCTCACACCATGAG 0: 1
1: 0
2: 2
3: 13
4: 113
Right 954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954192608 Original CRISPR CACCATGAGCAACTGGGCAC AGG Intronic
900731890 1:4267500-4267522 CAGCAGGAGCAACAGGGCAGCGG + Intergenic
902555496 1:17244368-17244390 CACCATGGGCACCAGGACACAGG + Exonic
904064972 1:27742461-27742483 CACCACGAGGGACTGGGCCCTGG + Intronic
904252754 1:29236649-29236671 CAGCACGAGCGCCTGGGCACGGG - Exonic
905504916 1:38470450-38470472 CCCCATGAACAAGTGGGCAAAGG - Intergenic
905922446 1:41728512-41728534 CAGCATGAGCAAATGTGCAGGGG + Intronic
907752599 1:57277437-57277459 GACCAAAAGCCACTGGGCACTGG + Intronic
907967601 1:59348121-59348143 CCCCATCAACAACTGGGCAAAGG + Intronic
907979052 1:59462626-59462648 CCCCATCAGCAAGTGGGCAAAGG + Intronic
908740525 1:67322811-67322833 CAGCATGAGCCACAGTGCACAGG + Intronic
911453809 1:98098189-98098211 CATAAGGAGCAAGTGGGCACAGG + Intergenic
912429867 1:109623451-109623473 CCCCCTGAGCAGCTGGGCAGCGG + Intronic
912552483 1:110493191-110493213 CACCAGGGCCAACTGGGCAGGGG - Intergenic
915287092 1:154860066-154860088 CAGCAAGAGCAGCTGGGCAGGGG - Intronic
915313702 1:155016945-155016967 CCCCAGGAGCAGCTGGGGACAGG - Exonic
915771137 1:158425990-158426012 AACCTTGAGAAACTGGGCAATGG - Intergenic
920943006 1:210501628-210501650 CCCCAGGAGCAGCTGGGGACAGG - Intronic
921544194 1:216454619-216454641 CACCAGGAACCACTGGACACTGG - Intergenic
921683447 1:218061774-218061796 TACCATGAGCATCTAGACACAGG - Intergenic
1065276272 10:24089117-24089139 CCCCATCAGCAACTGGGCGAAGG - Intronic
1066012502 10:31207711-31207733 CCCCATGAAAAACTGGGCAAAGG + Intergenic
1066067855 10:31775184-31775206 CACCTTGTGGCACTGGGCACTGG - Intergenic
1066201862 10:33149744-33149766 CACCATGAGCCACAAGGCAATGG + Intergenic
1066997779 10:42579540-42579562 CTCCATGATTAACTGGGCACAGG - Intronic
1069321937 10:67182857-67182879 CCCCATCAACAACTGGGCAAAGG + Intronic
1069600546 10:69703457-69703479 CACCATGAGAAAATGGAGACAGG - Intergenic
1069756891 10:70778930-70778952 AACCATGTGCATCTTGGCACAGG - Intronic
1072727533 10:97823832-97823854 CACCAGGAGCAAGAGGCCACTGG + Intergenic
1073102409 10:101013406-101013428 AACCATGGGCAATGGGGCACAGG + Intronic
1073476367 10:103756513-103756535 CCCCAGGAGCCTCTGGGCACTGG - Intronic
1074833571 10:117267450-117267472 CACCATGAAAAACTTGTCACCGG - Intronic
1075324402 10:121519201-121519223 CTCCATGAGCAACTAGACATGGG + Intronic
1077343336 11:2035691-2035713 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1078087462 11:8242865-8242887 CACCATGAGCACCAGGGGATGGG + Intronic
1078293119 11:10035583-10035605 CCCCATCAACAAGTGGGCACAGG + Intronic
1078395877 11:10981511-10981533 CACCTTCAACAACTTGGCACAGG + Intergenic
1078592581 11:12657530-12657552 CACCAGTAGCAACTAGGCAATGG + Intergenic
1079335634 11:19568124-19568146 CAACAGGGGCAAATGGGCACAGG - Intronic
1081622655 11:44628143-44628165 CACCACCAGGCACTGGGCACTGG + Intergenic
1082065900 11:47900066-47900088 CACCAAGAGAAAGTGGGTACTGG + Intergenic
1082814928 11:57501363-57501385 CACCAGGAACAGCTGGGCACAGG + Intronic
1083611574 11:64006943-64006965 CACCATCATCAACTGGGGTCAGG + Intronic
1085663867 11:78395034-78395056 CACACTGGGCAACTGGGCACTGG + Intronic
1087837051 11:102885897-102885919 CACAAAGAACAACTGGGCGCTGG + Intergenic
1089494295 11:118900619-118900641 CACCCTGAGCAACATGGAACAGG - Exonic
1202826322 11_KI270721v1_random:90880-90902 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1096134225 12:49186401-49186423 CACCCTGAGCAACTTATCACAGG - Exonic
1096144674 12:49269863-49269885 CACCCTGAGCAACTCATCACAGG + Exonic
1097570131 12:61322019-61322041 CCCCATCAGCAAGTGGGCAAAGG + Intergenic
1098594881 12:72260474-72260496 CACTGGGAGCAACTGGACACGGG + Intronic
1100602374 12:96122857-96122879 CACCAACAGCAGGTGGGCACTGG + Intergenic
1100655585 12:96641246-96641268 CACCATCAACAAGTGGGCAAAGG + Intronic
1101292556 12:103386715-103386737 CACCAAAAGCAACTGGGGAAAGG - Intronic
1102452149 12:113049943-113049965 CACCATGATCTTCTGGCCACAGG + Intergenic
1103945213 12:124522444-124522466 CGCCAGGAGCCACTGGGAACTGG - Intronic
1105202676 13:18193540-18193562 CAGCGTGAGCAAGTGGGCAGAGG + Intergenic
1108982670 13:56538296-56538318 CTCCATTAAAAACTGGGCACAGG - Intergenic
1109904857 13:68827324-68827346 CCCCATAAGAAACTGGGCAAAGG + Intergenic
1111977161 13:94978283-94978305 CACCTTGAGCTAATGGGCAGTGG + Intergenic
1114302846 14:21393779-21393801 CAACAGGAGCATCTGGGCGCAGG + Exonic
1115477603 14:33831070-33831092 CCCCATGAACAAGTGGGCAAAGG + Intergenic
1116022007 14:39472755-39472777 CCCCATCAGCAAGTGGGCAAAGG + Intergenic
1116410323 14:44613317-44613339 CACCATCTGGAACTGGGCACGGG + Intergenic
1116770973 14:49126668-49126690 CCCCATGAACAAGTGGGCAAAGG - Intergenic
1119323173 14:73743481-73743503 CACCAGCAGCAACTGAGCCCGGG - Intronic
1120151413 14:81039166-81039188 CACCATGACCAACTGGGAGATGG + Intronic
1121733591 14:96203117-96203139 CAGGATGTGCAACTGGGGACAGG + Intergenic
1125244684 15:37621293-37621315 CACCATGAAAAAGTGGGCAAAGG - Intergenic
1125561642 15:40638451-40638473 CAGCATGAGCCACTGTGCCCAGG + Intronic
1126995983 15:54445618-54445640 CCCCATCAACAACTGGGCAGAGG - Intronic
1128668220 15:69554127-69554149 CACCAGGAACAAGTGGGCAGTGG + Intergenic
1132605810 16:793292-793314 CACCGTGAGCATCTGGGCCGAGG - Intronic
1133359231 16:5160700-5160722 CACCTTGAGCAGCTGAGCAGGGG - Intergenic
1135071169 16:19353118-19353140 CAGCATGAGCCACTGTGCCCAGG - Intergenic
1135552945 16:23412292-23412314 GTCCCTGAGAAACTGGGCACGGG - Intronic
1136452041 16:30359035-30359057 CACCATAAGCAGCTGGGGGCTGG - Intronic
1137448001 16:48543970-48543992 CTCCTTGAGCAACCTGGCACGGG - Intronic
1138549753 16:57740867-57740889 CACCATGAGAGAGTGGGCATGGG - Intronic
1139429913 16:66905502-66905524 CCCTAAGAGCACCTGGGCACTGG + Intergenic
1140131278 16:72164102-72164124 CGCTGTGAGCAACTGGGCTCAGG + Intronic
1140809075 16:78559600-78559622 CACTATTAGCAAATGGCCACTGG + Intronic
1142057013 16:88004364-88004386 CCCCTTGAGCAACAGGGCACCGG + Exonic
1142299125 16:89246630-89246652 CAACATGAGCACATGGACACAGG + Intergenic
1142840802 17:2627871-2627893 CACCAAGAGCAACTAAGCAGAGG - Intronic
1143501902 17:7344038-7344060 CAGCTGGTGCAACTGGGCACAGG - Exonic
1143502669 17:7348202-7348224 CACCGGGAGCAGCTGGGCCCTGG - Exonic
1143582757 17:7836118-7836140 CACCAACAGCAGCTGGGCCCGGG - Intergenic
1147304725 17:39555410-39555432 CACCAAGAGCAAGTGGGCAGAGG - Intronic
1148742922 17:49902870-49902892 CAGCCTGGGCAACTGGGCAACGG + Intergenic
1152314494 17:79572367-79572389 CACAATGAGCTCCTGGACACAGG - Intergenic
1153791110 18:8580631-8580653 CAACACAAGCAACTGGGCATGGG - Intergenic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1155427901 18:25725165-25725187 CATCATCTGCATCTGGGCACAGG + Intergenic
1157514093 18:48298662-48298684 CACCCTGAGCCACTGGCCCCTGG - Intronic
1159574351 18:70157118-70157140 AACCATGGGCAAGTGCGCACTGG - Intronic
1160391865 18:78540125-78540147 CACAGAGAGCAATTGGGCACAGG + Intergenic
1162350554 19:10146382-10146404 CACCATCACCAACTCGGTACAGG + Exonic
1162821245 19:13224918-13224940 CACCAAGAGAAACTGAGTACTGG - Intronic
1164560612 19:29289509-29289531 TCCCATGAGCAGCTGGGCACAGG - Intergenic
1165001302 19:32765057-32765079 CCCCATCAGCAAGTGGGCAAAGG + Intronic
1165245395 19:34495656-34495678 CACGATGAGCATGTGGGGACTGG - Intronic
1165255840 19:34576885-34576907 AACCATGAGAATCTGGGCCCAGG - Intergenic
1165342799 19:35224725-35224747 CACCCTGGGCTACGGGGCACCGG + Intergenic
927025678 2:19066758-19066780 CTCTATGTGCCACTGGGCACTGG + Intergenic
927517564 2:23681057-23681079 CACCAGGACCCGCTGGGCACAGG - Intronic
928399346 2:30966598-30966620 TACCAGGAGCCACTGTGCACTGG - Intronic
928795841 2:35017746-35017768 CCCCATCAGCAAGTGGGCAAAGG + Intergenic
931251221 2:60531936-60531958 CACCATGAGCATCTGGGTTAAGG + Intronic
932028258 2:68157320-68157342 GACCATGGGCAACTTCGCACGGG - Exonic
932490075 2:72114772-72114794 CACCATGAGGACCTGGGTCCTGG + Intergenic
933214833 2:79618140-79618162 CTCCATGCTCCACTGGGCACTGG - Intronic
937837894 2:126492501-126492523 CACCTTGGGCACCTGGTCACAGG - Intergenic
938259020 2:129882073-129882095 CACCGTGAGTAAATGGGCTCTGG + Intergenic
940426692 2:153539214-153539236 CCCCATCAGAAACTGGGCAAAGG - Intergenic
941328383 2:164145088-164145110 GACCATAAGAAACTGGGAACTGG + Intergenic
943356161 2:186858703-186858725 CACCCTAAGCAAATGAGCACAGG - Intergenic
944600192 2:201295831-201295853 CCCCATGAACAAGTGGGCAAAGG + Intronic
944839402 2:203610732-203610754 CACCATGCACAACTGGGCTGTGG - Intergenic
945843420 2:214915155-214915177 CACCTTGAACTACAGGGCACAGG - Intergenic
945861653 2:215129552-215129574 CCCCATTAGAAACTGGGCAAAGG - Intronic
947769439 2:232659413-232659435 CTCCCTGAGCTCCTGGGCACAGG + Intronic
948031982 2:234826328-234826350 CAACATGACCAACTCTGCACTGG + Intergenic
1169066775 20:2698284-2698306 CAGCAGGACCAACTGGACACAGG + Intronic
1170769522 20:19319851-19319873 CCCCATGGTCAAATGGGCACAGG - Intronic
1175859310 20:62141946-62141968 CACTGTGAGCACCTGGGCAGGGG + Intronic
1176109273 20:63404186-63404208 AGGCATGAGCACCTGGGCACAGG - Intergenic
1176715276 21:10344465-10344487 CAGCGTGAGCAAGTGGGCAGAGG - Intergenic
1177809037 21:25905066-25905088 CAACAGGCTCAACTGGGCACAGG + Exonic
1178220859 21:30658398-30658420 CACCATCAACAAGTGGGCAAAGG - Intergenic
1179327598 21:40363846-40363868 CACCATCAACAAGTGGGCAAAGG + Intronic
1181040176 22:20188349-20188371 CAGCCTCAGCAACTGGGCAGGGG + Intergenic
1181313565 22:21958245-21958267 CACCCTCAGGACCTGGGCACAGG - Intronic
1183521539 22:38298580-38298602 CACCATGGGCAGCAGGGCCCAGG - Intronic
1184313659 22:43665550-43665572 CACCCTGAGCTACGTGGCACGGG - Intronic
1184744237 22:46446846-46446868 AACCAAGAGCAACTGGGTTCTGG + Intronic
950721207 3:14883944-14883966 CAGCATGAGCAAATGCTCACAGG + Intronic
951572502 3:24079773-24079795 CACCATCAACAAGTGGGCAAAGG - Intergenic
952043262 3:29285509-29285531 CATCATTGGCAACTGGGCACTGG - Intronic
952437039 3:33281867-33281889 CCCCATCAACAACTGGGCAACGG - Intronic
954192608 3:48974716-48974738 CACCATGAGCAACTGGGCACAGG + Intronic
956623701 3:71246346-71246368 TGCCATGAGCAAAAGGGCACAGG + Intronic
957871775 3:86098255-86098277 CCCCATCAGCAAGTGGGCAAAGG + Intergenic
958949367 3:100400623-100400645 CACCATGTCCAAGTGAGCACCGG + Exonic
961019263 3:123490620-123490642 CACCATGATCAAGTCGTCACTGG + Intergenic
961330520 3:126135479-126135501 CACCATCAGCTTCTGGGCAGTGG - Intronic
963477033 3:145820510-145820532 CACCATTAACAAGTGGGCAAAGG - Intergenic
964692714 3:159469603-159469625 CACCATGAGCACTGGGGAACAGG + Intronic
969621606 4:8281572-8281594 CGCAATGAGCAACTGGGCTGGGG - Intronic
973238177 4:47928674-47928696 CAGCATAAGCCACTGGACACTGG + Intronic
974357232 4:60828461-60828483 CAACATGAGCCGCTGTGCACAGG + Intergenic
977450020 4:97183573-97183595 CACCATGAGCAACTAGATAATGG - Intergenic
978012652 4:103706815-103706837 CAGGATCAGCAACTGGGGACTGG + Intronic
982037076 4:151356203-151356225 CACCATGATCAACTCAGCATGGG + Intergenic
984843280 4:184088273-184088295 CACCATCAAAAACTGGGCAAAGG + Intergenic
985317903 4:188678022-188678044 CACCATCAACAAGTGGGCAAAGG + Intergenic
986548264 5:8923782-8923804 CACCATGAGCTAAAGGGCTCTGG + Intergenic
987369444 5:17179865-17179887 CACCATGAGAAAATGTGCTCAGG + Intronic
988693508 5:33596097-33596119 GACCATGAGCATGTGGGCTCAGG - Intronic
989115543 5:37948992-37949014 CACCATGGGCAACTGGACCTTGG + Intergenic
990133276 5:52613639-52613661 CCCCATGAACAAGTGGGCAAAGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
994884056 5:105535815-105535837 TACCATGAGCAATTATGCACAGG + Intergenic
996234557 5:121109182-121109204 AACCATGAGAAAGTGGGCACCGG - Intergenic
997367829 5:133337043-133337065 CACCTCTGGCAACTGGGCACAGG + Intronic
997368232 5:133339327-133339349 CACCTCTGGCAACTGGGCACAGG + Intronic
998918896 5:147045830-147045852 CACCATGACCCTCTGGGGACTGG + Intronic
1004485946 6:16066636-16066658 AAATATGAGCAACAGGGCACAGG + Intergenic
1004507505 6:16258971-16258993 AACCAGGAGAAACTGGGCACAGG - Intronic
1005560474 6:27035266-27035288 CACATTGAGGAACTGGGCATGGG - Intergenic
1012368269 6:98469906-98469928 CAACATGAGCAACTGTCCAAAGG - Intergenic
1014569495 6:122991296-122991318 CCCCATGAAAAAGTGGGCACAGG + Intergenic
1014830415 6:126096596-126096618 CACCATGGGCATTAGGGCACTGG + Intergenic
1016777581 6:147921750-147921772 CACCATGGGCAACAGGCCAGGGG - Intergenic
1018658129 6:166059833-166059855 CACCATTAAAAACTGGGCAAAGG - Intergenic
1023732917 7:43209280-43209302 CAGCAGGAGCAACAGGGGACAGG - Intronic
1024313540 7:47992010-47992032 CACCATGAGCTGCTGGGGAGAGG - Intronic
1024947692 7:54827319-54827341 CCCCATGAAAAACTGGGCAAAGG + Intergenic
1026049883 7:66936735-66936757 TACCACGAGCAACTGCACACCGG - Intronic
1026831858 7:73615261-73615283 CACCATGGCCAATTGGGCAGAGG - Intronic
1027685425 7:81274288-81274310 CACCATGAGCTAAAGGGCTCTGG - Intergenic
1028325993 7:89525393-89525415 CCCCATCAACAACTGGGCAAAGG + Intergenic
1032125716 7:129191102-129191124 CAGCATGAGCAACTCAGAACTGG - Intronic
1032193693 7:129778358-129778380 CTCCAAGAGCCACTGGGCCCCGG + Intergenic
1032266735 7:130374797-130374819 CACTAGGAGGAACTGGGCAGGGG - Intergenic
1038377640 8:27058668-27058690 CACCATCAACAAGTGGGCAAAGG - Intergenic
1039603231 8:38859508-38859530 CACCATGTAGAAGTGGGCACGGG - Intergenic
1040078200 8:43261427-43261449 CCCCATGAAAAACTGGGCAAAGG - Intergenic
1041415913 8:57608916-57608938 CACCATGGGCTACAGTGCACTGG + Intergenic
1042412194 8:68478301-68478323 AAACTTGAGCAACTGGGAACTGG - Intronic
1043398867 8:79864503-79864525 ACCCATGAGCAAATGGGAACTGG + Intergenic
1043448925 8:80347192-80347214 CACCATATCCAACTTGGCACTGG - Intergenic
1045180577 8:99776935-99776957 CACCTTGACCAACTAGGCACAGG + Exonic
1046205206 8:110985408-110985430 CCCCATGAACAAGTGGGCAAAGG - Intergenic
1049717415 8:144099499-144099521 CTCCAGGAGCAGGTGGGCACAGG - Exonic
1049728543 8:144163416-144163438 CACTGTGAGGAACTGAGCACGGG - Intronic
1052564881 9:30136812-30136834 CACCATGATCAACTGGATGCAGG + Intergenic
1053104554 9:35398784-35398806 CACCATGAGCATATGGGAATGGG + Intronic
1053366482 9:37525996-37526018 CAGCATGAGTAACTGAGCCCTGG + Intronic
1056186788 9:84143146-84143168 CACCATGAAGAAGAGGGCACGGG + Intergenic
1056425819 9:86475558-86475580 CACCATCAACAAGTGGGCAAAGG - Intergenic
1056752015 9:89358604-89358626 CACCGTGAGCTGCTGGGCAGTGG + Intronic
1056956637 9:91087414-91087436 CACCATGAGAACCTCTGCACAGG + Intergenic
1058207568 9:102127644-102127666 CACCATCAACAAGTGGGCAAAGG - Intergenic
1060780634 9:126409679-126409701 CAGCATCAGAGACTGGGCACAGG + Intronic
1062048015 9:134433300-134433322 CACCAGCAGGACCTGGGCACCGG + Intronic
1186384478 X:9094770-9094792 CACCATCTGCCACTGGGCAGAGG + Intronic
1186642438 X:11470365-11470387 CACCAAGAGCCTCTGGGCATAGG + Intronic
1192006443 X:67218705-67218727 CACCATCAACAAGTGGGCAAAGG + Intergenic
1193031253 X:76900613-76900635 CACCATCAACAAGTGGGCAAAGG + Intergenic
1193547741 X:82850453-82850475 CACCATCAACAAGTGGGCAAAGG - Intergenic
1193992173 X:88321827-88321849 CACCATCAAAAACTGGGCAAAGG + Intergenic
1194630924 X:96282605-96282627 CACCATGAACAACATGGTACTGG + Intergenic
1195062316 X:101208212-101208234 CAGCATGAGCAAGTGTGCAGAGG - Intergenic
1195106064 X:101602140-101602162 CATCATGGCAAACTGGGCACTGG + Intergenic
1195106819 X:101611631-101611653 CATCATGGCAAACTGGGCACTGG - Intergenic
1195434033 X:104822067-104822089 CCCCATCAGAAACTGGGCAAAGG - Intronic
1197937282 X:131752892-131752914 CACCAGGAGGAACTGGGGCCCGG - Intergenic
1201063711 Y:10069935-10069957 CACCAGGGTCAACTGCGCACAGG - Intergenic
1201304235 Y:12537047-12537069 CACCATGCACAATTTGGCACAGG + Intergenic