ID: 954193928

View in Genome Browser
Species Human (GRCh38)
Location 3:48984914-48984936
Sequence TTCCTGTGTTGTCCCCAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954193922_954193928 24 Left 954193922 3:48984867-48984889 CCATGGCTGGTTGCAGGTTCCCT 0: 1
1: 0
2: 0
3: 19
4: 223
Right 954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 276
954193924_954193928 5 Left 954193924 3:48984886-48984908 CCCTTTTTCCTTCCTCAGGTTTT 0: 1
1: 0
2: 3
3: 118
4: 945
Right 954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 276
954193926_954193928 -3 Left 954193926 3:48984894-48984916 CCTTCCTCAGGTTTTGTCTCTTC 0: 1
1: 0
2: 5
3: 29
4: 375
Right 954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 276
954193927_954193928 -7 Left 954193927 3:48984898-48984920 CCTCAGGTTTTGTCTCTTCCTGT 0: 1
1: 0
2: 1
3: 46
4: 363
Right 954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 276
954193925_954193928 4 Left 954193925 3:48984887-48984909 CCTTTTTCCTTCCTCAGGTTTTG 0: 1
1: 0
2: 3
3: 59
4: 617
Right 954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954193928 Original CRISPR TTCCTGTGTTGTCCCCAGCA AGG Exonic
900418740 1:2546583-2546605 TTCCTGTTCTGTCCCCAGCTGGG - Intergenic
900480284 1:2894860-2894882 TTCCTGGGTTGTGCTCAGCCTGG + Intergenic
900974846 1:6010670-6010692 TTCCTGTGTTCACCTGAGCAGGG - Intronic
902821714 1:18947481-18947503 ATCCTGTGCTGTACCCAGAAAGG - Intronic
903222015 1:21874447-21874469 GTCCTGTGGTGTCCCCCGCTGGG + Exonic
903406102 1:23097633-23097655 TTACTGTGTTGTGCCCAGGCTGG - Intronic
903497141 1:23776962-23776984 ATCCTGTCTTTTCCCCACCAGGG + Intergenic
903925693 1:26829011-26829033 TGACTGTTTTGTCCCCAGCGAGG + Intronic
904807261 1:33140804-33140826 TTCCTCTGTTGTCCTCTCCAAGG - Intergenic
905534772 1:38712621-38712643 TTCCTGTGTTGTTATCACCAAGG - Intergenic
905865732 1:41375603-41375625 CTCCTGTTCTGTCCCCACCATGG - Intronic
907702325 1:56801201-56801223 TTCTTGTGCTCTCCCAAGCATGG + Intronic
907838361 1:58132638-58132660 TTCTTGTTTTCTCCCTAGCAGGG + Intronic
909065598 1:70931718-70931740 TTCCTGGGCTGCCCACAGCATGG + Intronic
912447765 1:109750788-109750810 TTGCTGTTTTGTTCACAGCACGG - Exonic
917757322 1:178115351-178115373 TCCCTGTTTTGTCCCCAGTCTGG + Intronic
919145773 1:193632878-193632900 ATCCTGGGTTGTCCCTAGCTTGG + Intergenic
921794953 1:219332177-219332199 TTCATGTGGTGTCTCCAGCAGGG - Intergenic
922164474 1:223103403-223103425 TTCCTGTCTCCTCCCCAGGAAGG - Intergenic
922989812 1:229897038-229897060 TTCCTTTCTTGACCCCAGCGTGG + Intergenic
924233434 1:241981181-241981203 TTACTGTGTGATCCCCAACATGG - Intergenic
924448346 1:244155336-244155358 TTCCTCAGCTGTCCGCAGCAAGG - Intergenic
924855555 1:247871931-247871953 TTGCTGGGTTATCCCCTGCAGGG - Intronic
1062875805 10:942209-942231 TTCCTGAGCTGTCTCCATCATGG - Intergenic
1066140353 10:32499504-32499526 GTCCTGTGTTTTCCCAACCATGG + Intronic
1067653564 10:48174419-48174441 ACCCTGTGTTGTACCCACCAGGG - Intronic
1067655925 10:48191174-48191196 TTCATGTGGGGTCTCCAGCAAGG - Intronic
1067764174 10:49072704-49072726 TCCCTGTGGTGTCACCAGCAAGG - Intronic
1068616332 10:59122033-59122055 TTTCAGGGTTGTCCCAAGCATGG + Intergenic
1068680867 10:59818397-59818419 TTCCTGTGTTGCCTGCATCATGG - Intronic
1068918429 10:62458359-62458381 TTCCTTTTTTGTCTTCAGCATGG + Intronic
1069916470 10:71790065-71790087 CTCATGTTTTCTCCCCAGCAGGG + Intronic
1069992219 10:72322769-72322791 GCCCTGTGTTGTCCCCAGGTTGG - Intergenic
1070720990 10:78757020-78757042 TTCCCCTGTTTCCCCCAGCACGG + Intergenic
1071267884 10:83980511-83980533 CTTCTGTGTTGGCCCCAGAATGG - Intergenic
1072090127 10:92119127-92119149 TTACTGTGTTGTCCTCTGTAGGG + Intronic
1072303688 10:94086554-94086576 TGCCTGTGTTTTCCCCACTAGGG + Intronic
1073500191 10:103929918-103929940 TTTCTATGTTCTCCACAGCATGG + Intergenic
1075631920 10:124005600-124005622 TTCCTCTGTTGTCAAAAGCATGG - Intergenic
1075680175 10:124325827-124325849 TTCCTGTGGTATCCACAGCCTGG - Intergenic
1075926135 10:126253174-126253196 TTCCTGTGCTGGACCCTGCAGGG - Intronic
1076388295 10:130075408-130075430 GGCCTGTATTGTCCCCTGCAAGG - Intergenic
1077550892 11:3199814-3199836 TTCCTCGGTTGTCTCCAGAATGG + Intergenic
1079033285 11:17001522-17001544 TTCCTGTGTTCTCTCCCGCTGGG - Intronic
1079084613 11:17436342-17436364 TTCCTGTCTTACCCCCAGCTAGG - Intronic
1079719260 11:23789751-23789773 TTCCTTTATTGTCCCCAAAAAGG - Intergenic
1079860597 11:25665865-25665887 TACATGTGTTTTCTCCAGCAAGG + Intergenic
1080405764 11:31977582-31977604 TTCCTTTGATGTCCCCAACAGGG + Intronic
1083592902 11:63905617-63905639 TTCCTGTGTTGGACCCAGGGTGG + Intronic
1083939037 11:65885272-65885294 TTCCTCTTTTGTCCCCAGGGGGG - Intronic
1086347760 11:85914836-85914858 TTCCTGAGTCCTCCCCAGCCTGG - Intronic
1089496963 11:118912849-118912871 TCGCCCTGTTGTCCCCAGCAGGG - Intronic
1091800768 12:3323261-3323283 TCCCAGTGAGGTCCCCAGCAAGG - Intergenic
1092127303 12:6083957-6083979 TTTCTCTGTTGTCCCCAGTGGGG - Intronic
1093824827 12:23671082-23671104 TTCCTGTGTTTTTCCCAGTCTGG - Intronic
1095221297 12:39619423-39619445 TTTCTGTGTTCTCTGCAGCAGGG + Exonic
1095300679 12:40580931-40580953 TTCCTGAGTCCTCCCCAGCAAGG - Intergenic
1095659185 12:44709330-44709352 TTCCTATGGTCTCTCCAGCAGGG - Intronic
1096546240 12:52342029-52342051 TTCCTATGATGTCCCCACCACGG - Intergenic
1097309282 12:58100731-58100753 TGCCTGTGTTTTCCCAAGCCTGG - Intergenic
1099772592 12:87081178-87081200 TTTCTGTGGTCTCTCCAGCATGG + Intergenic
1100548401 12:95624409-95624431 TTTCTGTGTTTTCCCTAGAAGGG + Intergenic
1103375612 12:120453288-120453310 TTCCTGAGTTTTAACCAGCAGGG + Intronic
1104572066 12:129934221-129934243 TTCCTGTGCTGTTCTCAGGATGG + Intergenic
1106169991 13:27280575-27280597 TTCCTGTCTTCTTCCCATCAAGG - Intergenic
1109422398 13:62131017-62131039 TTCCTGTGGTCTCCCCAGCCTGG - Intergenic
1109466587 13:62741682-62741704 CTGCTATTTTGTCCCCAGCATGG + Intergenic
1110619255 13:77577297-77577319 TTCCTGAGGCCTCCCCAGCAAGG - Intronic
1110817775 13:79880634-79880656 TACCTTTGATGTGCCCAGCAGGG + Intergenic
1111436821 13:88221844-88221866 TTCTTGTGTTCTCTCCAGTAGGG - Intergenic
1112586715 13:100724945-100724967 TTGCTGTGGGGTCCCCAACAGGG + Intergenic
1113465293 13:110508259-110508281 TTCTTGCTGTGTCCCCAGCAGGG - Intronic
1120646353 14:87079271-87079293 ATCATGTTTTGTCCCCAGCTTGG + Intergenic
1122207416 14:100154924-100154946 CTTTTGTCTTGTCCCCAGCAGGG + Intronic
1122278036 14:100605264-100605286 TTCAAGGGATGTCCCCAGCAGGG + Intergenic
1123061414 14:105596391-105596413 CTCCTGTGCTGACCACAGCATGG + Intergenic
1123085870 14:105717302-105717324 CTCCTGTGCTGACCACAGCATGG + Intergenic
1125771800 15:42172700-42172722 TTCCTGTTTTGTTTCCAGCTGGG + Intronic
1126166786 15:45660261-45660283 TTCAAGATTTGTCCCCAGCAGGG + Intronic
1128113217 15:65089354-65089376 TTCCTTTGTTGACCTCTGCAGGG - Intergenic
1128461738 15:67873970-67873992 ATGCTGTGCTCTCCCCAGCAGGG + Intergenic
1128514939 15:68336081-68336103 TTCCTTTATTTTCTCCAGCAGGG - Intronic
1129372345 15:75105409-75105431 TTCCTGTGTGGCCCTCAGAAGGG - Intronic
1130043311 15:80424255-80424277 TCTCTGGGTTGTCCCCAGAAGGG + Intronic
1131729822 15:95267955-95267977 GTCCTGTGTTTTCCCCTCCATGG + Intergenic
1132700207 16:1219030-1219052 TGGCTGTGTCGTCCCCAGCCAGG + Exonic
1137717360 16:50606420-50606442 TTCCAGTGTTCTCCAGAGCAGGG + Intronic
1138126533 16:54443350-54443372 TGCATGTGTCCTCCCCAGCATGG - Intergenic
1138290214 16:55840318-55840340 TTCCTGTGGTTTCCCCGGGAAGG - Intergenic
1139441951 16:66972800-66972822 TTCCTGTGCTGTCCCCCAGAGGG - Intronic
1140733399 16:77876406-77876428 TTCCAGTGTTGTCCCCACAGAGG - Exonic
1141384143 16:83603841-83603863 TTCCTGAGGTCTCCCCAGCCAGG - Intronic
1141848484 16:86627555-86627577 CTCCTGGGGTGTCTCCAGCATGG + Intergenic
1142260741 16:89041470-89041492 TTCCTGGGTTCAGCCCAGCATGG - Intergenic
1142518096 17:446399-446421 TTTCTCTGGTGTGCCCAGCATGG - Intergenic
1144221001 17:13099705-13099727 TTGCTCTGTTATCCCCAGCCTGG - Intergenic
1144702632 17:17349023-17349045 CTCCTTTCTTGTCCCCAGCAGGG + Intergenic
1146150629 17:30466691-30466713 TTGCTGTAATGTCCCAAGCAGGG - Exonic
1147587004 17:41658572-41658594 TTCCTGTGCTCTCCCCAACAAGG + Intergenic
1148857428 17:50586413-50586435 TTCCCTTGCTGTCCCCAGCTGGG + Intronic
1149225069 17:54460607-54460629 TTCATGTATTGTCCCCACCAGGG + Intergenic
1151323639 17:73366013-73366035 TTCCTCTGTCCTCCCCATCAGGG - Intronic
1151509199 17:74547913-74547935 TTCCTGTCTCCTCCCCAGCCTGG - Intergenic
1152656549 17:81522529-81522551 TTCCTTTCCTTTCCCCAGCACGG + Intronic
1152919528 17:83059041-83059063 CACCTGTGCTGTGCCCAGCAAGG + Intergenic
1153012494 18:551710-551732 TTCCTGTGTTGTTTAGAGCAGGG + Intergenic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
1157683829 18:49627244-49627266 TGCCTGGGTTGCCCCCAGCGTGG + Intergenic
1159066359 18:63572370-63572392 TTCCTGTGATGTTTACAGCATGG - Intergenic
1159610411 18:70518733-70518755 TTCCTCTTCTGTCCTCAGCAGGG + Intergenic
1160673001 19:375140-375162 TTGCTGGAGTGTCCCCAGCAAGG - Intronic
1161136987 19:2625729-2625751 TCCTTGTCTTGTGCCCAGCACGG - Intronic
1163330504 19:16634253-16634275 CTCATGTGAAGTCCCCAGCATGG - Intronic
1165407163 19:35637933-35637955 TTCCTGTGTTCTCAGCACCAAGG + Intergenic
1165707852 19:37989059-37989081 TTCCTGTGGTTTCCCCAGCACGG + Intronic
1165780341 19:38429741-38429763 TTCCTTTGTAGTCATCAGCACGG - Intergenic
1165807940 19:38593200-38593222 ATTCTGAGGTGTCCCCAGCAAGG - Intronic
1165972287 19:39641946-39641968 TTCCTCTGTTTCCTCCAGCAAGG - Intergenic
1168150980 19:54448561-54448583 TTCCGGGATTGTCCACAGCACGG - Intergenic
1168288153 19:55344638-55344660 TGCCTGCGTTGTTCCCTGCAAGG - Intronic
925154359 2:1638557-1638579 ATCCTGTGTTCCCTCCAGCAAGG + Intronic
926121422 2:10243191-10243213 TTCTTGTGTCGTCGCCAGCGAGG - Intergenic
926135294 2:10331793-10331815 ATCCTGTGGTGGCCCCAGCTGGG + Intronic
927141428 2:20133582-20133604 GTCCAGTGATGTCCCCAGAAAGG + Intergenic
928078382 2:28286308-28286330 TTCCTATAATGCCCCCAGCATGG - Intronic
928362697 2:30678608-30678630 TTCCTGGGGTGTCTGCAGCAAGG - Intergenic
930717114 2:54603568-54603590 TGCCTGTCTTGTTCCCAGCTGGG - Intronic
931177645 2:59869959-59869981 TTCCTGTGGTGTTCTCAGGAAGG + Intergenic
931840894 2:66146843-66146865 ATCCTGTGTTGTCTCAAGAAGGG - Intergenic
932192486 2:69752574-69752596 TTTCTGTGATTTCCCCAGCATGG + Intronic
932884934 2:75541108-75541130 TGCCTGTGTTGTCCTCAGGGAGG - Intronic
933199681 2:79434807-79434829 TTCCTGGGTTCTCTCCTGCATGG + Intronic
934818968 2:97355451-97355473 TTCCAGTGATGTCCAAAGCATGG - Intergenic
936029156 2:109057867-109057889 CTCCTGGTTTGGCCCCAGCATGG + Intergenic
937174222 2:119910794-119910816 TTCCTGAGGTCTCCCCAGCCAGG + Intronic
937311921 2:120908034-120908056 ATCCTGTGCTGTCCACACCAGGG - Intronic
938956897 2:136307288-136307310 TGGCTGCGTTCTCCCCAGCACGG - Intergenic
939342620 2:140918545-140918567 TTCCTGTACTCTCACCAGCATGG + Intronic
945821955 2:214675158-214675180 TTCTCATATTGTCCCCAGCATGG - Intergenic
946310485 2:218880351-218880373 TCCCTCTGTTGCCCTCAGCAGGG + Exonic
947084294 2:226433733-226433755 TTCCTGTTGGGTCCTCAGCAGGG + Intergenic
947751470 2:232534973-232534995 ATGCTGGCTTGTCCCCAGCAAGG - Intronic
948369728 2:237481060-237481082 TGCCACTGTTTTCCCCAGCATGG + Intergenic
948838497 2:240637556-240637578 GTCCAGTCTTGTCCCCAGCCAGG + Intergenic
1168762266 20:357265-357287 TTCCTGTGTCCTCTCCAGCCAGG + Intronic
1168923322 20:1558877-1558899 TTCCTGTCTAGTTCCAAGCAGGG - Intronic
1169467924 20:5857777-5857799 TTGCTCTGTTGTCCCCAGGTTGG - Intronic
1169751392 20:8998285-8998307 TTTCTGGATTATCCCCAGCAGGG + Intergenic
1173087161 20:39934106-39934128 TTCCTGAGTCCTCCCCAGCCAGG - Intergenic
1173350105 20:42237027-42237049 CTCCTGTGATCTCTCCAGCATGG - Intronic
1175500206 20:59444693-59444715 TCCCTGTGTGGTGCTCAGCACGG - Intergenic
1176389013 21:6154219-6154241 TCCCTGTGTCATGCCCAGCAAGG + Intergenic
1176883919 21:14230776-14230798 TTCCTGAGGCCTCCCCAGCAGGG + Intergenic
1176913697 21:14599429-14599451 TTCCTGAGGCCTCCCCAGCAAGG + Intronic
1178155996 21:29854758-29854780 TTCGTTTGTCTTCCCCAGCAAGG + Intronic
1178594684 21:33942565-33942587 TCCCTGTTTTGTTGCCAGCATGG + Intergenic
1178608178 21:34057421-34057443 TCCCTGTCCTGTCCCCAGCCTGG + Intergenic
1179247812 21:39648867-39648889 TTCCTGTTGTGTCCCCACAACGG - Intronic
1179320863 21:40290028-40290050 TCCATGTCTTTTCCCCAGCAAGG - Intronic
1179734459 21:43384029-43384051 TCCCTGTGTCATGCCCAGCAAGG - Intergenic
1181443264 22:22949522-22949544 ATGCTGTGCTGTCCCCAGCATGG - Intergenic
1182094174 22:27614944-27614966 TCCCTGTGGTGTCCCAACCAGGG - Intergenic
1184436935 22:44484878-44484900 TTCTTGTGTGCTCCCCACCATGG + Intergenic
1184658898 22:45956285-45956307 ATCCTGTGGCGTCCACAGCACGG + Intronic
1184748455 22:46470405-46470427 TTCCTGGGCTGCCCCCAGGAAGG - Intronic
1184921894 22:47610971-47610993 GGCCTGTGCTGTCCCCCGCAGGG + Intergenic
949565520 3:5241397-5241419 TTCATGTTTTGTTGCCAGCAAGG + Intergenic
949641339 3:6038459-6038481 TTCCTGTGGCATCCCCATCAAGG - Intergenic
950574862 3:13826125-13826147 TTCCTGGGAACTCCCCAGCAGGG - Intronic
950881126 3:16323334-16323356 TTCCTAGGTTTTCCTCAGCAGGG - Intronic
951385116 3:22032275-22032297 TTCCTGAGTCCTCCCCAGCCTGG - Intronic
953036988 3:39220704-39220726 TTCCTGTGTTGCCACCTTCAGGG + Intergenic
953082594 3:39634696-39634718 GTCCTTTGTTGTCCCATGCATGG - Intergenic
953431949 3:42847321-42847343 TTTCTGTGCTGTCCCCAGCCTGG - Intronic
953456229 3:43044488-43044510 ATCCTGTGTGGTCCTCAACATGG + Intronic
954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG + Exonic
954316930 3:49806337-49806359 TTCCTGTGCTGGCCCCGGCCTGG - Intronic
956055053 3:65289933-65289955 TTCCTCTTGTGTCCCCAGCAAGG + Intergenic
956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG + Intergenic
957648938 3:82974011-82974033 TACCAGTTTTGTCCCCAACAGGG - Intergenic
959297602 3:104557013-104557035 TTCCTCTGCTGTCCTCACCAAGG + Intergenic
961994204 3:131223821-131223843 TTCCTGTGGAGTCCACAGAAAGG + Intronic
962144264 3:132823493-132823515 TCCCTCTTTTGTCCCCAGGATGG + Intergenic
962849554 3:139297896-139297918 CTCCTCTGTTGTCTTCAGCATGG + Intronic
968078586 3:195830869-195830891 TTCCTGTGTTGTCCTCCCAAAGG - Intergenic
969049750 4:4364248-4364270 TTCCTGTGTGGCCCCAGGCATGG + Intronic
971474117 4:27056492-27056514 AGCATGTGTTGTCCCCACCAGGG - Intergenic
972874425 4:43340964-43340986 TACCTGTGGTCTCCCCATCATGG + Intergenic
973828242 4:54731370-54731392 TTCTTATGTTGTCCCAACCAAGG + Exonic
974742102 4:66020890-66020912 TTCCTGAGGCTTCCCCAGCAAGG - Intergenic
974827992 4:67153753-67153775 TTTCAGAGTTGTCCCCAGCTGGG + Intergenic
976817144 4:89161893-89161915 TTCCATTGTTCTCCCCAGAAAGG - Intergenic
977372991 4:96163944-96163966 TTCCTCTCCTGTCCCCTGCAAGG - Intergenic
978362375 4:107944993-107945015 TTCCTTTGTTGTCTCCAGACGGG - Exonic
978403079 4:108350890-108350912 TTCCTGTGTTTTCCCCTTGATGG + Intergenic
978419176 4:108511803-108511825 ATGCTGTGTTGCCACCAGCAAGG - Intergenic
978499028 4:109388584-109388606 TTTCTCTCTTGTCCCCAGAATGG - Intergenic
979840819 4:125437362-125437384 TTCCTCTGTTGTCTCTAGCCAGG - Intronic
980266562 4:130524204-130524226 TCCCTGGGTTGTACACAGCAGGG + Intergenic
981043029 4:140240598-140240620 ACCCTGTGTTCTCCCCAGGATGG - Intergenic
983356730 4:166670463-166670485 TTTCTGTGATATCTCCAGCAAGG - Intergenic
984916133 4:184726540-184726562 TGCCTGTGTTCCCACCAGCAGGG - Intronic
985727829 5:1524968-1524990 CTGCTGTGTTGGCCCCAGCTGGG + Intergenic
986070194 5:4275425-4275447 GTCCTGTGATGATCCCAGCAGGG + Intergenic
986479891 5:8176146-8176168 GTCCTGTGGTGCCCACAGCAAGG - Intergenic
987158963 5:15120340-15120362 TTGCTTTGTTGTGACCAGCATGG - Intergenic
987522299 5:19002809-19002831 TTCATGTGGAGTCTCCAGCAAGG - Intergenic
989146700 5:38257698-38257720 TTCCTGGGTTGTCTCCTGAATGG - Intergenic
991711908 5:69416342-69416364 TAACTGTGATGGCCCCAGCAGGG - Intronic
992547919 5:77833167-77833189 ATCCTGTGTTGTCTTCAGTAAGG - Intronic
992879178 5:81088201-81088223 TCCTTGTGCTGTCCCCAGCCTGG + Intronic
993196385 5:84752336-84752358 TTCCTATGTTGCCCCCAGGCTGG - Intergenic
993225897 5:85167061-85167083 TTCCTAGGTTGTACACAGCAGGG - Intergenic
996636269 5:125692919-125692941 TTCCTGTGTTGTTCCCATGGTGG + Intergenic
997260582 5:132462994-132463016 TTCCTCTCTTGGGCCCAGCAGGG - Exonic
997410712 5:133688823-133688845 TTTCTGTTTTGTCCCTACCACGG + Intergenic
1001227216 5:169955237-169955259 GTCCTGTGTGGTCCCGGGCAGGG - Intronic
1001311215 5:170612343-170612365 TCTCTGTGCTGTGCCCAGCAGGG - Intronic
1004145988 6:13066799-13066821 TTCCTATGGTCTCTCCAGCAGGG + Intronic
1005840627 6:29742626-29742648 TTCCTGTCTGGTTCCTAGCAGGG + Intergenic
1006060330 6:31414260-31414282 TTCCTGCTCTGTCCCTAGCAGGG - Intronic
1006072772 6:31509027-31509049 TTCCTGCTCTGTCCCTAGCAGGG - Intronic
1006752237 6:36385975-36385997 TTCCTGTGTTGTCCTCACCAGGG - Intronic
1007244792 6:40453161-40453183 TTCCTGTTGTGTACCCTGCAGGG + Intronic
1007644006 6:43366879-43366901 TTGCTCTGTCGTCCCCAGCCTGG + Intronic
1009396828 6:63208941-63208963 TTTCTGTGTTGACTCCAGGAAGG - Intergenic
1012158810 6:95856829-95856851 GTCCTGAGTTCTCCCCAGGAGGG - Intergenic
1013173475 6:107658127-107658149 TGCCTGGGTTCTCCCCAGCTGGG + Intronic
1018391045 6:163342318-163342340 TTCATATGAGGTCCCCAGCAGGG - Intergenic
1018943612 6:168329093-168329115 CTCCTGTGCTTTCCCCAACATGG + Intergenic
1018995495 6:168706895-168706917 TTCCTGTGTTAGCCACTGCAGGG + Intergenic
1019124303 6:169828869-169828891 TCCCTGTGTCGCCCCCATCAGGG - Intergenic
1019124313 6:169828901-169828923 TCCCTGTGTCGCCCCCATCAGGG - Intergenic
1019124324 6:169828933-169828955 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124335 6:169828965-169828987 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124346 6:169828997-169829019 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124357 6:169829029-169829051 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124368 6:169829061-169829083 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124379 6:169829093-169829115 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124390 6:169829125-169829147 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124401 6:169829157-169829179 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124412 6:169829189-169829211 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124423 6:169829221-169829243 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124434 6:169829253-169829275 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124445 6:169829285-169829307 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019124456 6:169829317-169829339 TCCCTGTGTCGCCCCCACCAGGG - Intergenic
1019770994 7:2883510-2883532 TCACTGTGGTGGCCCCAGCAGGG + Intergenic
1021732039 7:23605195-23605217 TTAATGTGTTTTCCCTAGCATGG + Intronic
1022722402 7:32953109-32953131 TGCCTGTGACCTCCCCAGCATGG + Intergenic
1023168393 7:37365615-37365637 TTCCTGTGTTGTCTTCACCCTGG - Intronic
1025142059 7:56474818-56474840 ATCCTGGGATCTCCCCAGCAGGG - Intergenic
1026300877 7:69096966-69096988 TTGCACTGTTGTCCCCATCATGG - Intergenic
1027255849 7:76430372-76430394 GTCCTGTGCTGGCCTCAGCATGG + Intronic
1027267510 7:76502502-76502524 GTCCTGAGCTGTCCCCTGCAGGG + Intronic
1027319325 7:77002367-77002389 GTCCTGAGCTGTCCCCTGCAGGG + Intergenic
1030443293 7:109616113-109616135 TTCCTGTTATGTCTCCTGCAGGG - Intergenic
1031084024 7:117284498-117284520 TTCCTGTTGTGGCCCAAGCAAGG - Intronic
1031572691 7:123378463-123378485 TTCCTGCGGTGTCCCTAGAATGG + Intergenic
1032251848 7:130264484-130264506 TTCCATTGTTCTTCCCAGCAAGG + Intergenic
1032322216 7:130895811-130895833 TTTTTGTCTTGTCCCCAGCTGGG + Intergenic
1034002821 7:147435103-147435125 TTCCTGTGTTACCCAGAGCAGGG - Intronic
1034870035 7:154675822-154675844 TTCCTCTCCTGTCCACAGCAGGG + Intronic
1034942456 7:155239588-155239610 TTCCTGTTCTGTCCCCAGGTGGG + Intergenic
1034950774 7:155296014-155296036 TTTATGTGTTGTCTCCAGAATGG - Intergenic
1035310455 7:157964567-157964589 CTCCTGTGTTGTGGCCTGCACGG - Intronic
1035871743 8:3142529-3142551 TTCATGCGTTGTGCTCAGCAGGG + Exonic
1036219719 8:6911145-6911167 TTCCTGCTGTGTCCCCAGCTTGG + Intergenic
1036749423 8:11434552-11434574 TTCCTGTGGAGTCCTCGGCAGGG - Intronic
1037695279 8:21218023-21218045 TTCCTGTCTTGTCTTCCGCAAGG + Intergenic
1039951802 8:42178855-42178877 CCCCTGGGTTGTGCCCAGCATGG + Intronic
1041326338 8:56670192-56670214 TTACTGTGGTATGCCCAGCATGG + Intergenic
1041694378 8:60720356-60720378 TTCCTGGATTGGCCCCAGAAAGG + Intronic
1042993475 8:74667003-74667025 TTCATGTGATCTCTCCAGCAGGG + Intronic
1049014015 8:139906915-139906937 GTGCTGTGCTGTCCTCAGCAGGG - Intronic
1049363580 8:142225715-142225737 TACCTGTGTTGGCCTCATCACGG - Intronic
1049667577 8:143853304-143853326 TTGCTGTGTTGCCCCGAGCAGGG + Intergenic
1050201269 9:3148441-3148463 TTGCTCTGTTGTCCCCTGCTGGG + Intergenic
1053887367 9:42654186-42654208 GTCCTGTGTGGTCCCAGGCAGGG - Intergenic
1054226389 9:62461637-62461659 GTCCTGTGTGGTCCCAGGCAGGG - Intergenic
1055793943 9:79954245-79954267 TTCCTGTGTTGTTCTCATGAAGG + Intergenic
1056565721 9:87771066-87771088 TTCCTGTTTAGTCCACAGAAAGG - Intergenic
1057020145 9:91690999-91691021 TTCCTGGATTGTCGCCAGAAAGG + Intronic
1057512677 9:95693731-95693753 TTCCTGTGGCCTCCCCAGCATGG + Intergenic
1059458146 9:114412700-114412722 TTCCTGAGTTGGCCCAATCAGGG + Intronic
1059498366 9:114729399-114729421 TTCCTTTGGTGCCCCCAGCAAGG + Intergenic
1059626264 9:116070018-116070040 TTCCTGTGATGTCTTCAGTAGGG + Intergenic
1060877201 9:127091936-127091958 CTCCTGGGTTTTCCCCAGCAAGG - Exonic
1061724106 9:132572147-132572169 TGCCTGTATCTTCCCCAGCAAGG + Intronic
1061820666 9:133225757-133225779 TTCCTGTGGGGTGTCCAGCAGGG - Intergenic
1062510850 9:136905064-136905086 TGCCTGTGCTGTCCAGAGCAGGG + Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1187438603 X:19295776-19295798 TTCCTGAGGTCTCCCCAGCCTGG + Intergenic
1187615542 X:20989965-20989987 TTGTTGTGCTGTCCTCAGCATGG + Intergenic
1189247292 X:39572932-39572954 TTCATGTGGTGTCTCCAGGATGG - Intergenic
1189800851 X:44690719-44690741 TTTCGGTCTTGTCGCCAGCAGGG + Intergenic
1193152614 X:78140356-78140378 GTCCTGTGTTGGCCTCAGCGGGG - Intergenic
1199864406 X:151829875-151829897 TCCCTGTGTCGCCCCCATCATGG - Intergenic