ID: 954195947

View in Genome Browser
Species Human (GRCh38)
Location 3:48997322-48997344
Sequence CTATGTGTTGAGTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954195947 Original CRISPR CTATGTGTTGAGTGGGAAGA TGG (reversed) Intronic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902658506 1:17885837-17885859 TTATGTGTTGAGTGGTTGGATGG + Intergenic
903486815 1:23695622-23695644 CTGTGTGTTGCGTGGGATGCTGG + Intronic
904562599 1:31408808-31408830 CTAGGGGTTGAGAGAGAAGATGG - Intergenic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904807382 1:33141363-33141385 CTATGTGCTGACTGGGAACCAGG + Intergenic
905392804 1:37648765-37648787 CTATGTGTTGCATAGGATGAGGG + Intergenic
905935086 1:41817098-41817120 CTATGTGTTAAGTGCTATGATGG - Intronic
905989607 1:42323610-42323632 CTATGGGTTTACTGAGAAGAGGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906751860 1:48270738-48270760 TTTTTTGTGGAGTGGGAAGATGG - Intergenic
907542795 1:55231670-55231692 CCAGGTGTTGAGTGAGAAAAAGG - Intergenic
907679506 1:56550507-56550529 TTATGTTTTGATTTGGAAGAGGG - Intronic
908356882 1:63330516-63330538 CTATCTGTTGAGAGGAAAGTGGG - Intergenic
909943398 1:81635955-81635977 ATATGTGCTGAGTGTGAGGACGG - Intronic
910486692 1:87722609-87722631 CAGGGAGTTGAGTGGGAAGATGG - Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
915030959 1:152880203-152880225 CTAGGTTTTGAGAGGGACGAGGG - Intronic
915049172 1:153049528-153049550 CAATGTGTGGAGTGAGCAGATGG - Intergenic
915267733 1:154731036-154731058 CTATGTGCTGAGAGGGGAAAAGG + Intronic
915623486 1:157099981-157100003 CTAAATCTTGAGTGGGAAGGAGG + Intergenic
916856866 1:168759056-168759078 CACTGGGTTGAGTGGGCAGAAGG + Intergenic
917756336 1:178102824-178102846 GTATTTATTGATTGGGAAGAGGG - Intronic
918659055 1:187066720-187066742 CTATATGTTACTTGGGAAGAAGG + Intergenic
920748065 1:208647617-208647639 GTGTGTGTTGTGTAGGAAGAGGG - Intergenic
920823686 1:209404425-209404447 CTATGTGGTGAGGGAGGAGAAGG - Intergenic
921189405 1:212696505-212696527 ATGTGTGTTGAGTGGAAAGGGGG + Intronic
921232105 1:213083468-213083490 TTGTGTATTGAGTGGGTAGAGGG + Intronic
921828604 1:219701911-219701933 CTATGTGTTGATTGAAAAGGGGG + Intronic
922016507 1:221653853-221653875 CTATATCTTGACTGGGATGATGG + Intergenic
922026621 1:221755680-221755702 CTATATGTTGAGAGGAGAGAAGG + Intergenic
924487044 1:244495039-244495061 CTGTGTTTTGAGTGAGAAGGAGG - Intronic
1063939321 10:11110627-11110649 CTGTTTGGTGAGTGGGGAGATGG + Intronic
1064490370 10:15849609-15849631 CTATGTGTTAAGTGGGGCAAAGG + Intronic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065748141 10:28860647-28860669 TTATGAGTTGAGTGGGTAGCAGG + Intronic
1066471120 10:35699240-35699262 CTATGTGTAAAGGGGCAAGAGGG + Intergenic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1068612268 10:59073323-59073345 CAATGCCTTGAGTGGTAAGAGGG - Intergenic
1068750854 10:60590225-60590247 AAATGTGTTGAGTGTGAATAGGG + Intronic
1071228614 10:83560745-83560767 CTGTGTTTTGAGTGTAAAGATGG - Intergenic
1071709242 10:88032940-88032962 CAATGAGATGAGTGGGAAAATGG + Intergenic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074297531 10:112204387-112204409 CACTGGCTTGAGTGGGAAGAGGG + Intronic
1074435424 10:113430201-113430223 ATATGGGTTGAGGGGGAGGAGGG + Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075464805 10:122643287-122643309 CTGTGTGTTGAGGTCGAAGAGGG + Exonic
1075882918 10:125869836-125869858 ATAAGAGTTGAGTGGAAAGATGG + Intronic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1078652485 11:13208642-13208664 CTGTGTATTGAGTGAGAAAATGG - Intergenic
1079311985 11:19375012-19375034 CCATGTCTTGACTGGGAAGCTGG - Intronic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081307269 11:41528773-41528795 CTTTGTTTTGAGGGGGAAAAAGG - Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1084788932 11:71461163-71461185 TTATGTGTTCAGTGGTAAAATGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1085252521 11:75152997-75153019 GTATGTGGTGAGTGGGTGGAGGG - Intronic
1085613961 11:77980245-77980267 CTAGGTGTTCAGTGGGGAGTGGG - Intronic
1087018623 11:93579550-93579572 CTAGGGGCTGAGTGGGAGGAGGG + Intergenic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1088114293 11:106298260-106298282 CTGTAAGTTGAATGGGAAGATGG + Intergenic
1088305758 11:108405636-108405658 CTATGTGTTCAGTAGGAATATGG + Intronic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1090255486 11:125280879-125280901 CTAGGGGGTGAGTGGGAAGCGGG - Intronic
1091358435 11:134956094-134956116 CTATCTGTTTAGAGAGAAGAGGG + Intergenic
1091541028 12:1462721-1462743 CTATATTTTGACTGGGGAGATGG + Intronic
1091835311 12:3581717-3581739 CTGACTGTTGATTGGGAAGAAGG - Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1094408493 12:30145144-30145166 CTCTGTATTGAGGGGGAAGGGGG - Intergenic
1095843978 12:46726074-46726096 CTATGGGTTGAATGGGGAGAGGG - Intergenic
1099981860 12:89613380-89613402 CTAAGAGTTGACTGGGTAGAGGG - Intronic
1103661617 12:122524656-122524678 CTATTTGTTTAGTGTTAAGATGG - Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1105450422 13:20494475-20494497 GTGTGTGTTCAGTGGAAAGATGG - Intronic
1109122476 13:58475312-58475334 CTATGTGATGTCTGTGAAGATGG - Intergenic
1115729482 14:36252980-36253002 CTATGGGTGGAAGGGGAAGAGGG + Intergenic
1117572585 14:57062507-57062529 GCATGTGGTGAGTGGGGAGAGGG + Intergenic
1118110246 14:62710606-62710628 GTAAGTGGTGAGTGGGAAGGGGG - Intronic
1118221191 14:63855861-63855883 ATGAGTGTTGAGTGGAAAGAAGG + Intronic
1118279106 14:64412534-64412556 TTATGAGTTGATTGTGAAGAGGG + Intronic
1118691767 14:68346813-68346835 GTATGTGTTTACTGGGAGGAGGG - Intronic
1119148781 14:72339574-72339596 CTATGTAAAGAGTGGGAAGTGGG + Intronic
1120583654 14:86285148-86285170 GCATGTTTTGAGTGGGAACAGGG + Intergenic
1121023765 14:90599337-90599359 CTATGTGCTGTGAGGGGAGAGGG - Intronic
1122225029 14:100270764-100270786 TTCTGTGTTGAGTGTGAAGATGG - Intronic
1123015468 14:105371904-105371926 CTGTGTGTTGTGTGGTGAGAGGG + Intronic
1123223005 14:106874008-106874030 CTTTGTGGTGAATGGTAAGAAGG + Intergenic
1123980117 15:25594405-25594427 CTATGTGTTGAATGGGAAAAGGG + Intergenic
1124067740 15:26361837-26361859 CATTGTGTTGAGTGGAGAGAAGG + Intergenic
1124335783 15:28856057-28856079 CTAAGCGTGGAGTGGAAAGAGGG - Intergenic
1124690244 15:31815718-31815740 CTATGCTTTGGGTAGGAAGATGG - Intronic
1126734933 15:51721346-51721368 CCATCTGTTGAGTGGGGAGAGGG + Intergenic
1128645559 15:69376398-69376420 CTAAGGCTAGAGTGGGAAGACGG + Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130448332 15:84025407-84025429 CCATGTGTTCAGTGGGAACCAGG + Exonic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1131824387 15:96306321-96306343 CTCTGGGTTCAGTGGGAAGTTGG + Intergenic
1132413894 15:101606694-101606716 GTTTGTGTTGGGTGGGAACATGG + Intergenic
1133361888 16:5180556-5180578 CTTTGAATAGAGTGGGAAGAAGG - Intergenic
1135869037 16:26131853-26131875 CTATCTGTTGAGTGAATAGATGG - Intronic
1137970140 16:52976582-52976604 CTAAGTTTTGGTTGGGAAGAAGG + Intergenic
1138065184 16:53933489-53933511 CAATGTTTTGTGGGGGAAGAAGG - Intronic
1138535615 16:57658783-57658805 CTATCTGTGAAGTGGGAGGATGG - Intronic
1140218045 16:73023933-73023955 CTATCTGTAGACTGGGTAGAAGG + Intronic
1142624548 17:1183444-1183466 CGAGGGGCTGAGTGGGAAGAAGG + Intronic
1143877175 17:10000840-10000862 GTATGTGCTGATTGGGTAGATGG - Intronic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1149506764 17:57200847-57200869 ATATGTGATGAGGGAGAAGATGG - Intergenic
1154496510 18:14965124-14965146 CTATCTGTTTAGAGAGAAGATGG - Intergenic
1155510302 18:26569642-26569664 TTAATTGTTGAGGGGGAAGAAGG + Intronic
1157274681 18:46302284-46302306 CTCTCTGTGGAGTGGGTAGAAGG + Intergenic
1157947598 18:51998264-51998286 TTGGGTGCTGAGTGGGAAGAAGG + Intergenic
1158144589 18:54297729-54297751 CTTTGTGTTGTTTGGAAAGAGGG - Exonic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1161831782 19:6610934-6610956 CAATGTGTTCAGTGAGATGAAGG - Intergenic
1164425831 19:28140968-28140990 CTGTGTCTTGAGTGTTAAGAGGG + Intergenic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165696034 19:37901655-37901677 CTAGGTGATGAGTGAGAAGGAGG + Intronic
1166485152 19:43206084-43206106 CTCTGTGTTGTCTGGTAAGAGGG + Intronic
1167720191 19:51174092-51174114 CTATGTGTTCAGTGAGGGGAAGG + Intergenic
1167977974 19:53246718-53246740 CTAGGTGCTGAGTGGGGAAATGG + Intronic
1168364823 19:55777307-55777329 CTTTGAGTTGAGTGGCAAAAGGG - Intergenic
925084350 2:1096081-1096103 CCATGTGTTGAGGAGGAAAACGG + Intronic
925783063 2:7401247-7401269 CTATGTGTAGAGTGTGGACAGGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928010653 2:27604472-27604494 CTATGTGTTGAGTGTGATAGTGG - Intronic
928719787 2:34106643-34106665 CCAGGGTTTGAGTGGGAAGATGG - Intergenic
928959908 2:36913417-36913439 CTATTTGTTGAATGGGAGGTGGG - Intronic
929761600 2:44811595-44811617 GTAAGTGTTCAGTGGGAACAAGG - Intergenic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933560560 2:83880403-83880425 CAATGTGGAGAGTAGGAAGAGGG - Intergenic
934971957 2:98770945-98770967 CCATGTGATGACCGGGAAGATGG - Intergenic
935309029 2:101764716-101764738 CTAGGTTATGAGTGGCAAGAAGG - Intronic
935554858 2:104498506-104498528 CTATTTGTGGACTTGGAAGATGG - Intergenic
937131072 2:119514038-119514060 CTATGTGTTGAGTGAGACAAAGG - Intronic
937948482 2:127364586-127364608 CTGTGTGATGAGTGGAGAGATGG - Intronic
938701944 2:133887422-133887444 CTATGTGCTTAGTAGGAAGAAGG + Intergenic
941012179 2:160313041-160313063 CGCTGTGCTGAGTGGGATGAAGG + Intronic
942111554 2:172687862-172687884 CTTTGTGTTCAGTGGGCAGCAGG - Intergenic
943769664 2:191702990-191703012 TTATATCCTGAGTGGGAAGACGG + Intergenic
944300572 2:198120049-198120071 CTATGTGTCATTTGGGAAGATGG + Intronic
1168959824 20:1861339-1861361 ATATGTGTGGGGTGGGTAGAGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170532034 20:17302939-17302961 CTATGTTTGGAATGAGAAGAAGG + Intronic
1171045645 20:21807926-21807948 GAATCTCTTGAGTGGGAAGAGGG - Intergenic
1173941499 20:46914832-46914854 CTGTGTGCTGAGTGTGACGATGG - Intronic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177523130 21:22256370-22256392 GTAAGTGTTGAGAAGGAAGAAGG + Intergenic
1177825003 21:26073136-26073158 GTATGTGTTGTGTGAGAAAATGG + Intronic
1178954981 21:37014023-37014045 CTATGTGTTGAGGGTGGACATGG + Intronic
1183894874 22:40960246-40960268 CTTTGAGTTGAGGGGGAAGGAGG + Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184276681 22:43412697-43412719 ATATGTGTTGAGTGAGTGGATGG - Intronic
950259991 3:11536653-11536675 CTATGGGTGCAGTGGCAAGAGGG - Intronic
950824314 3:15800667-15800689 CTAAGTGTTAATTGGGGAGAGGG + Intronic
952119557 3:30225924-30225946 CAATCTGTTGAGTGGGAGCAAGG - Intergenic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
954967647 3:54625431-54625453 CTATCTGTAAAGTGGGATGATGG + Intronic
954977215 3:54707495-54707517 CTAGGATTTGAGTGGGAAGGAGG + Intronic
956089605 3:65651825-65651847 CTTTGAGATGAGTGGGGAGAAGG - Intronic
958752336 3:98206553-98206575 TTATCTGGTGACTGGGAAGATGG - Intergenic
958962019 3:100519982-100520004 CTAAGTGTTGAGTGGATAAATGG - Intronic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959608493 3:108268006-108268028 CTAGGGGTTAAGTGGCAAGAAGG - Intergenic
960608237 3:119530347-119530369 GTATGTGTTGAGAGAGAATATGG - Intronic
961426196 3:126850453-126850475 CTATGTGATGAATGGGACGCAGG - Intronic
962724490 3:138209318-138209340 CTATGTGTTTAGTGAGAACTAGG + Intronic
963367453 3:144355015-144355037 CTATGTCTTTATTGGGATGATGG - Intergenic
963430193 3:145191398-145191420 GTATGTGTTGAGAGGCAAAATGG + Intergenic
965296675 3:166955799-166955821 CTGTGAGTTGAGTGGGAGCAGGG - Intergenic
966392990 3:179472753-179472775 TTATGTCTTGAGTTGGAAAAGGG + Intergenic
966682347 3:182656166-182656188 CTATTTGATGAGTGTGATGAAGG + Intergenic
966875731 3:184320593-184320615 CTATAAGATGAGTGGGAAGCAGG - Intronic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
972638536 4:40905416-40905438 CTCCGTGTTGTGTGTGAAGAAGG - Intronic
975727847 4:77309302-77309324 GAATGTGGAGAGTGGGAAGAGGG - Intronic
976221961 4:82763130-82763152 ATATGAGTTGGGTGGGAACACGG - Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
977114046 4:92998645-92998667 GTATGTGTTTTCTGGGAAGAGGG + Intronic
977257353 4:94756198-94756220 CTAAGTGTTTTGTGGGGAGAAGG - Intergenic
977405512 4:96592890-96592912 CTCTGTGGTGAGTGGTGAGAGGG + Intergenic
978077340 4:104549172-104549194 TTATGTCTTGAGTGGTAAGTAGG - Intergenic
981584435 4:146285938-146285960 CTGTGTTTTGAGTGGTGAGAAGG + Intronic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
982143846 4:152359934-152359956 ATAAGTGTTGAGAGGGAAGAAGG + Intronic
982596993 4:157398500-157398522 CATTTTGATGAGTGGGAAGAAGG + Intergenic
982924065 4:161313735-161313757 CTAGATGTAGAGTTGGAAGAAGG + Intergenic
982951497 4:161702811-161702833 TTGTTTTTTGAGTGGGAAGAGGG - Intronic
984612445 4:181856416-181856438 AAATGGGTTGACTGGGAAGAAGG - Intergenic
985553698 5:545916-545938 CTCTTTGTGGAGGGGGAAGAGGG + Intergenic
987005096 5:13702718-13702740 CTATGTGATGAGAGGGATGGAGG + Intronic
988501727 5:31789445-31789467 CTATGCCTTGAATGGAAAGAAGG - Intronic
988541087 5:32110686-32110708 CAATGAGATGTGTGGGAAGATGG - Exonic
989756737 5:44964246-44964268 TTATGTGTTGGGTGGGATGATGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990599472 5:57343060-57343082 CTATGTATTGATGGAGAAGAGGG - Intergenic
994348050 5:98711148-98711170 CCATGTGTTGAGGGGGAAATGGG - Intergenic
995064119 5:107841017-107841039 CTATGTGGTAAGGGGGAAGATGG + Intergenic
997888527 5:137654153-137654175 CTATGTTTTGATTGGGATGGTGG + Intronic
997890894 5:137675856-137675878 CTAAGTGTAGAGTGAGAAAATGG - Intronic
999366307 5:151026005-151026027 CCATGTGTAGATTGAGAAGAGGG - Intronic
1002836460 6:869142-869164 GTATTTCTTGAGTGGGAAGCTGG + Intergenic
1002945876 6:1760329-1760351 CTCTGTATTCAGTGGTAAGAAGG + Intronic
1003419969 6:5948474-5948496 TGAAGTGTTGATTGGGAAGAAGG - Intergenic
1003565086 6:7215932-7215954 CCATGTCTTGTGTGTGAAGAAGG + Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1005955703 6:30662018-30662040 ACATGTGTTGAGGGGGAAAAGGG - Intronic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1006797215 6:36739412-36739434 ATATGCTTTGAGTGGGAACAGGG - Intergenic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007703144 6:43775898-43775920 CAATAGGTTGATTGGGAAGAAGG - Intronic
1007705562 6:43788696-43788718 CCAAGTGTGGAGTGGGAAGGGGG - Intergenic
1008929682 6:56925519-56925541 CTACATTTTGAGTGGGAAAAGGG + Intronic
1008948276 6:57124034-57124056 CAATGTTGTGAGTGGCAAGAGGG + Intronic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1012242772 6:96892810-96892832 GAATGTGTAGAGTGAGAAGAAGG - Intronic
1014734573 6:125077472-125077494 CTATGTGTTGTTGAGGAAGAGGG - Intronic
1015701698 6:136042228-136042250 CCATGTGGGGAGTGGGGAGAAGG + Intronic
1017204021 6:151785870-151785892 CTGTGTGTTGAGTGTGAAGGAGG + Intronic
1017575246 6:155794842-155794864 GTATGTGTAGAGCGGGAAAATGG + Intergenic
1017910509 6:158788324-158788346 CTTTTGGGTGAGTGGGAAGAGGG - Intronic
1017986968 6:159452602-159452624 CTGTTTGTTGACTGGGGAGATGG + Intergenic
1020893199 7:13905640-13905662 GTATGTGGGGAGTGGGAAGGAGG + Intronic
1021055911 7:16045918-16045940 CTATTTCTTGAATAGGAAGAGGG + Intergenic
1022495354 7:30849882-30849904 CTGTGTTTTGAGTGGGCACATGG - Intronic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1027807750 7:82851017-82851039 CTATGTGTTGATTGGAATGTGGG + Intronic
1030015992 7:105221716-105221738 AGATGGGTTGAGTGGGGAGAGGG - Intronic
1030219736 7:107085169-107085191 CTCTGTGATGATTTGGAAGAAGG + Intronic
1030377621 7:108771506-108771528 ATCTGTGTTTAGTGGGAAGCAGG + Intergenic
1032464716 7:132136713-132136735 CTCTGTAGTGATTGGGAAGATGG + Intronic
1034519255 7:151606201-151606223 ATTTCTGTTGAGTGGGAATAAGG + Intronic
1034796983 7:154022650-154022672 GTATGTGTGGAGTGTGAAGTTGG + Intronic
1036019816 8:4831978-4832000 CTATGTGTGCAGTGGGAATTTGG - Intronic
1037462088 8:19121252-19121274 GGATGTGTTGAGTGGGCAGTTGG - Intergenic
1037683292 8:21116747-21116769 GCAGGTGGTGAGTGGGAAGATGG - Intergenic
1038957483 8:32483125-32483147 GTGTGTGTTGATTGGGGAGATGG + Intronic
1043267742 8:78287633-78287655 GTATGTGTTGGGAGGGTAGAGGG - Intergenic
1043291357 8:78605613-78605635 CTATGTGGGGGGTGGGTAGAGGG - Intergenic
1046169243 8:110483749-110483771 CTAAGTATTGAGAGGGAGGATGG - Intergenic
1047011909 8:120681770-120681792 CTATGTGGGGAGTGGGGAGGGGG - Intronic
1047236617 8:123047426-123047448 CTTTGACTTGAGTGGGAGGAAGG - Intronic
1049072712 8:140369187-140369209 GTAAGTGTTGCCTGGGAAGATGG + Intronic
1050866935 9:10512650-10512672 CAATTTGTTGAGAGGGAAGGAGG + Intronic
1055028503 9:71748044-71748066 CTAGATGTTGTATGGGAAGAGGG - Intronic
1055545189 9:77363962-77363984 CTATGTGTGGTGGGGTAAGAGGG + Intronic
1055968803 9:81890914-81890936 CTATGTGTTACTTGAGAAGAAGG + Intergenic
1056044265 9:82700800-82700822 CTATGAGTTTAGGGGGAAAAAGG - Intergenic
1059435996 9:114276669-114276691 CTGTTTGTTGATTGAGAAGACGG + Intronic
1059792296 9:117653290-117653312 ATAAGAGTTGAGTGGGAATATGG + Intergenic
1061507793 9:131041430-131041452 ATGTGTGGTGGGTGGGAAGATGG + Intronic
1186502842 X:10065902-10065924 CTCAGTGTTAAGGGGGAAGAAGG + Intronic
1186515554 X:10164079-10164101 CTGTGTGTTGAGTGAAAGGATGG + Intronic
1187466462 X:19531960-19531982 CTATGGGGTGGGTGGGAACAGGG + Intergenic
1188543256 X:31272631-31272653 AAATGTGTTGTGTGGGAGGAAGG - Intronic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1188633825 X:32402887-32402909 CTATCTAATGAGTGGCAAGATGG + Intronic
1189992381 X:46607482-46607504 TTGTGTGTTGATTGGGAAGCTGG - Intronic
1197749569 X:129955258-129955280 CTATATTTTGATTTGGAAGAAGG + Intergenic
1198216966 X:134564519-134564541 CTAAGTCTTGAATGTGAAGAAGG - Intergenic