ID: 954197345

View in Genome Browser
Species Human (GRCh38)
Location 3:49004608-49004630
Sequence TTTCCACTAAATAAAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954197345_954197352 15 Left 954197345 3:49004608-49004630 CCGCCCCCTTTATTTAGTGGAAA 0: 1
1: 0
2: 1
3: 13
4: 202
Right 954197352 3:49004646-49004668 ATAGCAGGTGTCTCTGTCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 214
954197345_954197350 0 Left 954197345 3:49004608-49004630 CCGCCCCCTTTATTTAGTGGAAA 0: 1
1: 0
2: 1
3: 13
4: 202
Right 954197350 3:49004631-49004653 TGTCAACATTTCCACATAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 190
954197345_954197354 25 Left 954197345 3:49004608-49004630 CCGCCCCCTTTATTTAGTGGAAA 0: 1
1: 0
2: 1
3: 13
4: 202
Right 954197354 3:49004656-49004678 TCTCTGTCTTTGGCATCTGAGGG 0: 1
1: 0
2: 3
3: 31
4: 410
954197345_954197353 24 Left 954197345 3:49004608-49004630 CCGCCCCCTTTATTTAGTGGAAA 0: 1
1: 0
2: 1
3: 13
4: 202
Right 954197353 3:49004655-49004677 GTCTCTGTCTTTGGCATCTGAGG 0: 1
1: 0
2: 3
3: 28
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954197345 Original CRISPR TTTCCACTAAATAAAGGGGG CGG (reversed) Intronic
902582352 1:17416064-17416086 TCTCCAAAAAAAAAAGGGGGGGG + Intronic
909985781 1:82159149-82159171 TCTCCACTCAAAAAAGGAGGGGG - Intergenic
910653512 1:89595910-89595932 TTTCCAAAAAATAAATGTGGAGG + Exonic
912157715 1:106942514-106942536 TTTCTACTGAATAAATGGAGAGG - Intergenic
913032191 1:114919538-114919560 ATTCCAAAAAATAAAGGAGGAGG - Intronic
914218682 1:145657522-145657544 TTTCCACTAATTTAAAGAGGTGG - Intronic
914471239 1:147980217-147980239 TTTCCACTAATTTAAAGAGGTGG - Intronic
914981431 1:152418059-152418081 TTGCCACTGAACAAAGGGGAAGG - Intergenic
915900651 1:159844338-159844360 TTTCCAAGAAAGAAAGGGGATGG - Intronic
920310218 1:205044141-205044163 TTTCCAGTAAGGAAAGGGGCTGG + Intronic
920990673 1:210936352-210936374 TTTCAACTAAATCAAGAAGGTGG - Intronic
921724555 1:218509117-218509139 TTTCCACAAACCATAGGGGGTGG - Intergenic
922902120 1:229145327-229145349 TTTCCAATAAGTAAAGGGACAGG + Intergenic
923755639 1:236788841-236788863 TATCCAAGAAATAAAGGTGGGGG - Intergenic
1063032764 10:2252638-2252660 TTTCTTCTAAAGAAAGAGGGAGG - Intergenic
1065322668 10:24523770-24523792 TTTCCACTACATCATGGGTGGGG + Intronic
1067276740 10:44842297-44842319 TTTCCAGGAAATAGAAGGGGAGG + Intergenic
1067929013 10:50540861-50540883 TTTCCATTTCATAAAGAGGGTGG + Intronic
1068034004 10:51737500-51737522 TTCCCATTACATAAAGGGGTAGG + Intronic
1070770343 10:79078847-79078869 TTTGCATTAAAAAAAGGGTGGGG - Intronic
1072380349 10:94862383-94862405 TTTCCACTAAAGAAAGGCCTGGG + Intergenic
1072831914 10:98667382-98667404 ATTCCAAAAAATAAAGGCGGAGG + Intronic
1073705357 10:105977298-105977320 TTTCCAAAAAATCAAGGAGGAGG - Intergenic
1076743103 10:132497838-132497860 TTTCAACCAAATAATGGCGGGGG + Intergenic
1078765803 11:14296814-14296836 TTACCATAAAAAAAAGGGGGGGG + Intronic
1080459354 11:32439465-32439487 CTTCAATTAAAAAAAGGGGGGGG + Intergenic
1080459753 11:32443769-32443791 TTTCTACCAAAGTAAGGGGGAGG - Intergenic
1080732399 11:34971801-34971823 CTTCCAGAAAATAAAGGAGGAGG - Intronic
1081747737 11:45484772-45484794 TTTCCACTCTATACAGGAGGGGG + Intergenic
1083835653 11:65265224-65265246 TCTCCAAAAAAAAAAGGGGGGGG + Intronic
1085713551 11:78852290-78852312 TTCCCATTAAATACAGGGTGTGG - Intronic
1085962854 11:81482937-81482959 TTTCCACTAAATCAAAGGAAGGG + Intergenic
1089468531 11:118702188-118702210 TTTCCAGGAAAAAAAGGAGGGGG - Intergenic
1091009421 11:131985071-131985093 TTTCAAGCAAATGAAGGGGGAGG - Intronic
1091031588 11:132194068-132194090 ATTCCAAAAAATAAAGGAGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092701175 12:11232495-11232517 TTTCCAGGAAATACAGGGGATGG + Intergenic
1093994419 12:25625986-25626008 TTTCCATTCAGTAAAGGAGGAGG - Intronic
1095750668 12:45707191-45707213 TTTGGACTAAATAGTGGGGGTGG - Intergenic
1096711981 12:53464324-53464346 CATCAACTAAATAAAGGGGAGGG - Intronic
1099615286 12:84926873-84926895 TTCCCAGAAAATAAAGGGTGGGG - Intergenic
1099980054 12:89588922-89588944 TTTACCCTAAATAAGGGTGGTGG - Exonic
1100020689 12:90066059-90066081 TTTCCACAAAATAAAGGGATGGG + Intergenic
1100195182 12:92237218-92237240 TTTTCACTTAATAAAAAGGGAGG - Intergenic
1100550195 12:95640028-95640050 TTTACAATAAATAAAAGGTGGGG - Intergenic
1105956906 13:25291972-25291994 TTTCCCCTCAATACAAGGGGTGG + Intergenic
1106803442 13:33280835-33280857 CTTCCATTAAATAAAGGGTTTGG - Intronic
1110103864 13:71645217-71645239 TATGCAGTAAATAAAGAGGGGGG - Intronic
1110336773 13:74341746-74341768 TTTCCAAAAAATCAAGGAGGAGG - Intergenic
1113776514 13:112949341-112949363 TTTCCAAAAAATAGAGGAGGAGG + Intronic
1114344915 14:21784358-21784380 ATTCCATTAAATAAAGGGTCAGG - Intergenic
1117435259 14:55709646-55709668 TTTATACTAAATAAAAGGGGAGG + Intergenic
1119826532 14:77661387-77661409 CTTCCACTAGATGAAGGGGTGGG + Intergenic
1120770715 14:88376827-88376849 TTTCCAAAAAATCAAGGTGGAGG - Intergenic
1123428467 15:20193083-20193105 TTTCCAGTAAATACAGTAGGTGG - Intergenic
1124210520 15:27760876-27760898 CTTCCAGAAAATAAAAGGGGAGG + Intronic
1126040098 15:44582180-44582202 TTTCCAGAAAATAAAAGAGGAGG + Intronic
1127197927 15:56610112-56610134 TTACCACAATAAAAAGGGGGAGG + Intergenic
1127225254 15:56920051-56920073 TTTCTTTTAAATAAAGGGTGAGG + Intronic
1127496951 15:59521944-59521966 TTTCCATTACATAAATGGTGGGG - Exonic
1127803135 15:62494611-62494633 TTTCAACTAAAGCACGGGGGAGG - Intronic
1128174673 15:65544635-65544657 TTTCAATTAAAAAAAGGGAGAGG + Intronic
1128374997 15:67067724-67067746 GATCCAGTCAATAAAGGGGGAGG + Intronic
1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG + Intergenic
1130804778 15:87308469-87308491 TTTCACCTAAAAAAAGGGGGTGG + Intergenic
1133627225 16:7582032-7582054 TTGTCACAAAAAAAAGGGGGGGG - Intronic
1135011202 16:18880707-18880729 TCTCCAAAAAAAAAAGGGGGGGG + Intronic
1135935514 16:26776687-26776709 TTGCCTCAAAATAAAAGGGGGGG + Intergenic
1136330270 16:29571231-29571253 TCTCCAAAAAAAAAAGGGGGGGG + Intergenic
1136855851 16:33656679-33656701 TTTCCAGTAAATACAGTAGGTGG + Intergenic
1138473431 16:57256666-57256688 CTTCCACTGAATAAGGGGGATGG + Exonic
1139227343 16:65245712-65245734 CATCCATAAAATAAAGGGGGTGG - Intergenic
1140971334 16:80015856-80015878 TTTACAAAAAATAAAGGGGGCGG - Intergenic
1203117436 16_KI270728v1_random:1505158-1505180 TTTCCAGTAAATACAGTAGGTGG + Intergenic
1149075316 17:52590402-52590424 TTTCCAAAACATAAAGGAGGAGG - Intergenic
1151901150 17:77016164-77016186 TTTCCAGTAACAAAAGGGGCAGG - Intergenic
1152005291 17:77676592-77676614 ATTCCATTAAATCGAGGGGGAGG + Intergenic
1152310943 17:79549384-79549406 TTTCCACTAGAGACAGGGAGAGG + Intergenic
1155116074 18:22768568-22768590 ATTCCAAAAAATAAAGGAGGAGG + Intergenic
1156162883 18:34381409-34381431 TTTCCAGTAAATAATGGTGAAGG + Intergenic
1158465214 18:57684361-57684383 TTTCCAAAAAAAAAAAGGGGGGG - Intronic
1162356683 19:10189945-10189967 TTTCATCTATAAAAAGGGGGTGG - Intronic
1163190101 19:15671040-15671062 TTGACACTAAAGAATGGGGGTGG + Intergenic
926823960 2:16883711-16883733 TTTCCAATAATTCAAGAGGGTGG - Intergenic
929140529 2:38662763-38662785 TTTCCTCTAACTAGAAGGGGAGG - Intergenic
931037538 2:58260257-58260279 TTTACAGAAAAAAAAGGGGGTGG + Intergenic
931783967 2:65602502-65602524 TTTCTACTAAAAAAAAGCGGGGG - Intergenic
933178280 2:79201088-79201110 TTTCCACAAAAAAAGGGGGGGGG - Intronic
935389850 2:102539614-102539636 TTTCCACTGAAGAAAATGGGAGG + Intergenic
936527073 2:113248653-113248675 TTTCCCTTTAATAAAGGGGGTGG + Intronic
940897182 2:159091948-159091970 TTTTCTGTAAATATAGGGGGGGG + Intronic
941287362 2:163630661-163630683 TTTGTACAAAAAAAAGGGGGGGG + Intronic
944051226 2:195472283-195472305 TTTCAAATAAAGAAAGGGGAAGG - Intergenic
944464083 2:199982869-199982891 TTTTTAATAAATAAAGGGAGTGG - Intronic
945526314 2:210891871-210891893 ATTCCAATAAATGAAGGAGGAGG + Intergenic
947211163 2:227709921-227709943 TTTCCATGAAAAAATGGGGGAGG + Intronic
1169183135 20:3588717-3588739 CTTCCAGTAAATAGAGGAGGAGG - Intronic
1170685324 20:18564431-18564453 TTTCCACAGAATGTAGGGGGTGG + Intergenic
1173396213 20:42682595-42682617 TTGCAACTAAATTAAGGAGGAGG + Intronic
1173742779 20:45413204-45413226 TTTCCACTAAAAATATGTGGTGG - Intergenic
1174510878 20:51051495-51051517 CTTCCACTGAACAAAAGGGGAGG + Intergenic
1175302250 20:57951290-57951312 TCTCCACCAAATAAAAGGGGAGG - Intergenic
1178165977 21:29977734-29977756 TTTCAACTTAATAAAATGGGAGG + Intergenic
1178503106 21:33141893-33141915 TTCCCCCAAATTAAAGGGGGAGG - Intergenic
1182011336 22:27003216-27003238 TTTCCAATAAAAAGAGGGAGGGG - Intergenic
1182188689 22:28435952-28435974 TTTCAATTAAAAACAGGGGGAGG - Intronic
1185022867 22:48390276-48390298 TTTCCATTAAATAAGGAGGGAGG + Intergenic
949700275 3:6748686-6748708 CCTCCACTAAAAAAAGGAGGAGG - Intergenic
951169932 3:19529517-19529539 TTTCCACTATCTAAGGGTGGTGG - Intronic
954197345 3:49004608-49004630 TTTCCACTAAATAAAGGGGGCGG - Intronic
955275379 3:57542143-57542165 TTTCCACTAAACTGGGGGGGGGG + Intronic
955366832 3:58317956-58317978 TCTCCAATATATAAAGGGGCTGG - Exonic
955628969 3:60951826-60951848 TTTTCCCTAAATAAAGGGAAAGG + Intronic
956661660 3:71604290-71604312 TTTCCAGAAAATAAAAGAGGTGG + Intergenic
959414196 3:106063452-106063474 TTTCCAGAAAATAGAGGAGGAGG + Intergenic
960676191 3:120197355-120197377 TTTCCACTCAATAAATGAAGAGG - Intronic
960812570 3:121638421-121638443 TTTCCATTTAAGAATGGGGGAGG + Intronic
961299651 3:125914665-125914687 TTTCATCTAAATCAAGAGGGTGG - Intergenic
961952729 3:130767028-130767050 ATTCCAAAAAATAAAGGAGGAGG + Intergenic
962541859 3:136390582-136390604 TTTCCAATAAATAAAAGGTGGGG + Intronic
963592006 3:147271881-147271903 GTTCCAAAAAATAAAGGAGGAGG + Intergenic
968021460 3:195394420-195394442 TTTCTACTAAACAAATGGGTTGG + Intronic
968252972 3:197239430-197239452 TTTCCAAAAAATTAAGGAGGAGG + Intronic
968697043 4:2036005-2036027 TTTCCAGAAAATTAAGGGGCTGG + Intronic
970384198 4:15539930-15539952 TCTCTAGTAATTAAAGGGGGTGG - Intronic
970974153 4:22023623-22023645 TATCCACTCAATGAAAGGGGAGG + Intergenic
973994082 4:56439128-56439150 ATTCAACTAAATTAAGGGGAGGG + Intronic
975104714 4:70554558-70554580 TATCCAATATATACAGGGGGTGG - Intergenic
976199476 4:82563991-82564013 CTTCCACAAAAAAATGGGGGAGG - Intergenic
976256907 4:83109377-83109399 TTTACACTAAAAGAAGGAGGCGG + Intronic
977296925 4:95220672-95220694 TTTCCCCTAAATCAATGGAGAGG + Intronic
977432990 4:96955940-96955962 TTTCAACTAAATAAAGATGCAGG - Intergenic
982774940 4:159431592-159431614 CTTCCCCTAAAAAAAGGTGGAGG - Intergenic
983168158 4:164504320-164504342 TTTCCATTCAACAAAGAGGGGGG - Intergenic
984400990 4:179263036-179263058 TTTCCAGTAAATTGAGGAGGAGG + Intergenic
984838461 4:184044891-184044913 GTTCCACTAAAAAAAGGAGAAGG - Intergenic
986674559 5:10171655-10171677 TTTCCTCTAATTAAAGGCAGGGG - Intergenic
988449307 5:31324020-31324042 TTTGTACCATATAAAGGGGGAGG + Exonic
988669495 5:33365891-33365913 CTTCTACTAAATAAAGGAGTTGG - Intergenic
990795982 5:59541582-59541604 TATTCCCTATATAAAGGGGGAGG - Intronic
991045994 5:62223431-62223453 TTTCCAGTAAATACAGTAGGTGG - Intergenic
991205603 5:64046559-64046581 ATTCCAAAAAATAAAGGAGGAGG + Intergenic
992080552 5:73232105-73232127 TTTCCCCAAAATCATGGGGGTGG + Intergenic
992317421 5:75571407-75571429 TGTCCACTAAATACTGGGGGAGG - Intronic
994263705 5:97689462-97689484 GGTCCACTCAAAAAAGGGGGTGG + Intergenic
999997705 5:157107862-157107884 TTTTCACATAAAAAAGGGGGGGG - Intronic
1001796183 5:174504223-174504245 TTTGCAGGAAATGAAGGGGGTGG + Intergenic
1002496267 5:179613925-179613947 CTTGCACAAAACAAAGGGGGAGG - Intergenic
1003833176 6:10037512-10037534 TCTCCAAGAAATAAAGTGGGGGG - Intronic
1006794728 6:36724566-36724588 TTACCACATAATAAAGGAGGAGG - Intronic
1007622515 6:43223600-43223622 TTCCTACAAAATAAAGGGGTTGG + Intronic
1008234093 6:49023184-49023206 ATTCCAAAAAATAAAGGAGGAGG - Intergenic
1010969878 6:82252079-82252101 TTTCCACCAAATTAAAGGGTGGG + Intergenic
1011187035 6:84688970-84688992 TTTCCATTAAATTAGGGGGTTGG + Intronic
1011464711 6:87643388-87643410 CTTCCAGAAAATAAAGGGAGAGG + Intronic
1011710221 6:90045441-90045463 TTTCAAATTAATAAAGGTGGGGG + Intronic
1013595225 6:111654747-111654769 TGGCCACTAAATAGAGGGGGTGG - Intergenic
1015551225 6:134414335-134414357 TTTCTAAAAAAAAAAGGGGGGGG + Intergenic
1015588624 6:134801682-134801704 TTTCTTCTGAATAAAAGGGGTGG - Intergenic
1016034492 6:139372890-139372912 TTTCAACTACATAAGGGAGGTGG + Exonic
1016165617 6:140938938-140938960 TTTCAACTAACTTAATGGGGAGG - Intergenic
1018408145 6:163509464-163509486 TGACCATTTAATAAAGGGGGGGG + Intronic
1019165418 6:170094960-170094982 TTCCCACTTAATCAAGGAGGAGG + Intergenic
1019746947 7:2706013-2706035 TGTCCACTAAGCAGAGGGGGTGG - Intronic
1020739785 7:12000136-12000158 TTTCCCCTAAATTCAGGGTGTGG + Intergenic
1022325338 7:29325797-29325819 TTTCCCCTAAAGAAAATGGGCGG - Intronic
1022832448 7:34081786-34081808 TTTACACCAAAGAAAGGGGAAGG - Intronic
1023204181 7:37730294-37730316 TTTCTACAAAATAAAGTGTGAGG + Intronic
1023212973 7:37828260-37828282 TTTCTACCAAATAAATGGGAGGG - Intronic
1023622740 7:42089261-42089283 TTTCCACTAATCAGAGGGTGTGG + Intronic
1024651968 7:51411061-51411083 TTTCCAGAAAATCAAGGAGGAGG + Intergenic
1027412973 7:77942127-77942149 TTTACACCAAACTAAGGGGGAGG - Intronic
1028428039 7:90713010-90713032 TTTCCACTGAAAACAGGGGTGGG - Intronic
1030005675 7:105117316-105117338 TTTCCATTAAATATGGGAGGGGG - Exonic
1030891602 7:115005724-115005746 TGTACACTAAATTAAGGCGGAGG + Intronic
1030990673 7:116295880-116295902 ATTCCAATAAATAGAGGAGGAGG + Intronic
1033382494 7:140836474-140836496 TTTCGAACAAATAAGGGGGGCGG + Intronic
1033676756 7:143548505-143548527 TTTCCATAAGATAAAAGGGGAGG - Intergenic
1033736104 7:144223354-144223376 TTTCCTTGAAATAAATGGGGTGG + Intergenic
1033746949 7:144327598-144327620 TTTCCTTGAAATAAATGGGGTGG - Intergenic
1034616828 7:152425108-152425130 TTTACAGTAAATAAAGGAGATGG - Intronic
1036100331 8:5775234-5775256 TTACAACTAAAAAAAGGGGAGGG - Intergenic
1038028871 8:23619056-23619078 TTTCCACAAGATAAAGCGGTTGG - Intergenic
1038166392 8:25088730-25088752 TTTCCAGTCAATAAATGGGATGG - Intergenic
1038207831 8:25484838-25484860 TTTCCACAAATTGAAGGGGTAGG + Intronic
1038665587 8:29534751-29534773 TTTCCAGAAAAAAAAAGGGGAGG + Intergenic
1039995659 8:42530671-42530693 TTTTAACTAAAAAAAGGGTGAGG + Intronic
1042003677 8:64156123-64156145 TCTCCATTAAAAAAAAGGGGAGG + Intergenic
1042082182 8:65066883-65066905 ATTCCACAAAATAGAGGAGGAGG - Intergenic
1042105750 8:65324427-65324449 TTTGCAGTAAATGAAGGGAGAGG + Intergenic
1043629717 8:82314665-82314687 TTCCCACAAAATAAAGTGGTTGG + Intergenic
1043945595 8:86248311-86248333 ATTCCAATAAATAGAGGAGGAGG - Intronic
1044033642 8:87269870-87269892 ATTCCACAAAATCAAGGAGGAGG + Intronic
1045901900 8:107291878-107291900 TTTCCACTGAAGATGGGGGGGGG + Intronic
1047182307 8:122600708-122600730 TTAGAACTAAATAAAGGTGGTGG + Intergenic
1047956624 8:129981455-129981477 TCTCCACTTAAAAAAGGGTGGGG - Intronic
1049643404 8:143725575-143725597 TCTCAAAAAAATAAAGGGGGCGG + Exonic
1050498886 9:6273170-6273192 TTTCCAATAAATAAAGGGAAGGG - Intergenic
1052722958 9:32194399-32194421 TTTGCAGTAAAAAAAGGGAGAGG - Intergenic
1052923701 9:33994477-33994499 TTTTCCCTAAACAAAGAGGGCGG + Intronic
1052952939 9:34228573-34228595 TCTCCAAAAAAAAAAGGGGGGGG - Intronic
1054814679 9:69463790-69463812 TTTCACCTAAACAAAGGTGGGGG - Intronic
1056768251 9:89458367-89458389 TTTCCACTAAAGAAAAGGGGCGG - Intronic
1057620150 9:96627532-96627554 TTTACAGGAAATATAGGGGGTGG + Intergenic
1060847652 9:126849868-126849890 TTTCTAGTGAATAAAGGTGGGGG - Intergenic
1186885535 X:13909695-13909717 TTCCCACTAAATAGAAGAGGAGG + Intronic
1189757910 X:44290560-44290582 TTTCCACAAAATAGGGTGGGTGG + Intronic
1193403824 X:81078447-81078469 TTTCATTTAAAAAAAGGGGGGGG + Intergenic
1193596985 X:83458882-83458904 TCACCACTAAAGAAGGGGGGCGG + Intergenic
1194070725 X:89322572-89322594 ATTCCACAAAATTAAGGAGGAGG + Intergenic
1194285316 X:92003415-92003437 ATTTCAATAAATAGAGGGGGAGG - Intronic
1195604945 X:106794823-106794845 TTACAAATAAATAAAGGGGGAGG - Intronic
1197251244 X:124218272-124218294 TGTTCATTAATTAAAGGGGGGGG + Intronic
1197410690 X:126112190-126112212 TTTACATTATATAAAAGGGGAGG - Intergenic
1197616318 X:128695724-128695746 TTTCCAGGAAATAAAATGGGAGG + Intergenic
1200602887 Y:5227957-5227979 ATTTCAATAAATAGAGGGGGAGG - Intronic
1200724963 Y:6658318-6658340 ATTCCACAAAATTAAGGAGGAGG + Intergenic