ID: 954198833

View in Genome Browser
Species Human (GRCh38)
Location 3:49012372-49012394
Sequence TGCTTGGTGTGGAGCCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954198830_954198833 5 Left 954198830 3:49012344-49012366 CCTTATCAGTGCAGGAGAGGATT 0: 1
1: 0
2: 1
3: 13
4: 122
Right 954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954198833 Original CRISPR TGCTTGGTGTGGAGCCATGA AGG Exonic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
904577895 1:31517283-31517305 TGCTTGGGGTGGAGCAGGGAGGG + Intergenic
904578716 1:31523815-31523837 TGCTTGGGGTGGAGCAGGGAAGG + Intergenic
904638003 1:31899472-31899494 TGGGCGGTGGGGAGCCATGAAGG - Intergenic
905214999 1:36400717-36400739 TGCCAGGTGTGGAGCAGTGAGGG + Intergenic
905476747 1:38234148-38234170 TGCTAGGTGTGGGGCTATGATGG - Intergenic
906261516 1:44395122-44395144 TGCTTGGGGTGGTTCCAGGAAGG + Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
908099797 1:60778663-60778685 TTCTTGCAGTGGAGCCAAGATGG - Intergenic
912511797 1:110194852-110194874 TTCTGGGTGTGGGGTCATGAAGG - Intronic
913301644 1:117376403-117376425 TGCTTGGCTTGGAGCCACTATGG + Intronic
914412712 1:147446957-147446979 TGCTTGCTGTGGAGTTCTGAAGG - Intergenic
915231090 1:154445817-154445839 AGCTTCGTCTGGAGCCTTGAAGG - Intronic
915604458 1:156941865-156941887 TGCTGGGTGTGGGGCCCTGCTGG + Exonic
916345778 1:163789850-163789872 TACTAGGTGTGTAGACATGAAGG - Intergenic
917451468 1:175151023-175151045 AGCTTGGTGGGGAGCCAGGCTGG + Intergenic
920753234 1:208702691-208702713 ACCTGGGTGTGGAGCCAAGATGG + Intergenic
922002713 1:221495994-221496016 TGTTAGATGTGGGGCCATGAAGG - Intergenic
923045596 1:230353597-230353619 TGTTTGGAGTGCAGCCCTGAAGG + Intronic
1065230761 10:23595916-23595938 TGATAGGGGTGGAGCCAAGACGG - Intergenic
1066639122 10:37537978-37538000 TGCAGGGGGTGGAGCCAAGATGG + Intergenic
1069256410 10:66336361-66336383 TGCTGGGGGTGGAGCTAAGATGG - Intronic
1070631532 10:78088446-78088468 TCCTTGGGGAGGAGCCAAGATGG + Intergenic
1071271710 10:84013820-84013842 GACTTGGTGTTGAGCCATGGAGG - Intergenic
1071860433 10:89666913-89666935 TGCTTGGTTTGTAGTCATAATGG - Intergenic
1073851951 10:107631900-107631922 TCCTTTGTCTGGAGACATGAAGG - Intergenic
1074311608 10:112327578-112327600 TCCTTAGTGTGAAGCCAAGAAGG + Intergenic
1077302503 11:1853795-1853817 TGGTTGGAGTGGGGACATGAGGG + Intronic
1078619699 11:12895727-12895749 TGGAAGGTGAGGAGCCATGAAGG - Intronic
1080486692 11:32715542-32715564 TGCTTGATGAAGAGTCATGATGG - Intronic
1081087742 11:38822393-38822415 TTTTTGGGGTGGAGCCAAGATGG - Intergenic
1082906051 11:58309743-58309765 TGATGGGAGTGGAGCCAAGATGG - Intergenic
1083676238 11:64326708-64326730 GGCTTGGGCTGCAGCCATGAAGG + Intergenic
1083719975 11:64599234-64599256 TGCCTGGTGTGGGGCCAGGGAGG + Intronic
1089061829 11:115632117-115632139 GGTTTGATGTGGAGCCATGAAGG + Intergenic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1091027282 11:132153022-132153044 TGCTTGCTGTAAAGCCATAAGGG - Intronic
1093816517 12:23555524-23555546 CGCTTGGTGGGGAGCAATTATGG - Intronic
1094135849 12:27125099-27125121 TGCTTGGCGTGGAGCGAATAAGG - Intergenic
1094185389 12:27636830-27636852 TGCTTGGCGTGGAGCGAATAAGG - Intronic
1094249933 12:28348107-28348129 TCCTTGGTGTGAAGAAATGATGG + Intronic
1096981814 12:55732473-55732495 TGCTTGGTGTGGAGGGACAAGGG - Intergenic
1102467251 12:113137134-113137156 TGCTGGGTGGGGAGTCAAGAAGG - Intergenic
1105538578 13:21293525-21293547 TCCTTGGTGTGGACTCACGATGG - Intergenic
1107960081 13:45549655-45549677 TGGTGGTTGTGGAGCCTTGACGG + Intronic
1109156368 13:58915079-58915101 TGATTGATGTGGAGTCAAGAGGG + Intergenic
1109572096 13:64206558-64206580 AGCTGGGTGTGGAGCGGTGAGGG + Intergenic
1109846974 13:68005797-68005819 TGATTAGTTTGGAGCCATGGGGG - Intergenic
1114425834 14:22621746-22621768 CACTTGGGGTGGAGCCAAGATGG - Intergenic
1116852240 14:49919964-49919986 AGTTTGGTGTGGAGCAATTAGGG - Intergenic
1116935857 14:50739438-50739460 TGCTGGTTATGGAGCCCTGATGG + Exonic
1118466106 14:66032598-66032620 GGTTTGGGGTGGAGCCAAGATGG - Intergenic
1120670882 14:87360839-87360861 TGTTTTGGGTGGAGCCAAGATGG - Intergenic
1202919459 14_KI270723v1_random:17618-17640 TGCTTGTTGTGGACCCATTGAGG + Intergenic
1202925171 14_KI270724v1_random:17376-17398 TGCTTGTTGTGGACCCATTGAGG - Intergenic
1124715023 15:32051784-32051806 TACTTGGGGAGGAGCCAAGATGG - Intronic
1126707876 15:51423229-51423251 TTCTTGGGGAGGAGCCAAGATGG - Intergenic
1127641502 15:60919923-60919945 TGCTTGGTGTTCAACCATGCAGG + Intronic
1133683949 16:8147937-8147959 TGCCTGGGATGGGGCCATGATGG - Intergenic
1133734106 16:8600891-8600913 TGCTTGGTGGGGATCCAGGAAGG + Intergenic
1134295523 16:12942035-12942057 TGCTTGGGCTGGAGCCATTTGGG + Intronic
1139585087 16:67897515-67897537 CTCTTGGTGTGGAGCCATCCAGG + Intronic
1139612379 16:68068308-68068330 TGCTTGGGTTGAAGCCAGGAGGG + Intronic
1143701935 17:8666977-8666999 TGCTTGGGGTGAAGCCATACTGG - Intergenic
1144666277 17:17104537-17104559 AGCCTGGTGGGGAGCCGTGAAGG + Intronic
1150569702 17:66375072-66375094 TGCATGGTATGCAGCCTTGAGGG + Intronic
1151743633 17:76000516-76000538 TGCTTGGTGTGGGGCCATGGAGG + Exonic
1152371733 17:79892513-79892535 TCCTGGGGGAGGAGCCATGATGG - Intergenic
1156534734 18:37851473-37851495 TGCTTGGAGTGGAGGCCTTAAGG - Intergenic
1156831865 18:41501494-41501516 TGCTTAGTGTTGAGCAATAAAGG - Intergenic
1156907565 18:42372019-42372041 TGCTTGGTGTTGAGGGAGGAGGG + Intergenic
1158010252 18:52720025-52720047 TGCTTGATGTGGAGAAAGGAGGG + Intronic
1158322687 18:56280755-56280777 TCAAGGGTGTGGAGCCATGAGGG - Intergenic
1161953011 19:7478088-7478110 TGCTGGGGGCGCAGCCATGAAGG + Intronic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165141774 19:33704114-33704136 AGCTTGGTGGGGAGCTAGGATGG - Intronic
1166988456 19:46676574-46676596 TCCTTGATGGGAAGCCATGAAGG + Intronic
1168153165 19:54459857-54459879 TGCTTAGTCTGCTGCCATGATGG + Intronic
1168327476 19:55545587-55545609 TGCTTTCTGGGGAGCCCTGACGG - Intergenic
925060708 2:887897-887919 TGCATGGTGGGGAGGCATCAAGG - Intergenic
926355162 2:12034771-12034793 TGCTGTGTGAGGAGCCTTGATGG + Intergenic
927101874 2:19794036-19794058 TGCTTGATGTGGAGCTAAGTCGG - Intergenic
931477559 2:62605233-62605255 TGCCTGGGGTGGAGCCAAGATGG + Intergenic
933966600 2:87434931-87434953 TGCTTGGAATGCAGACATGATGG - Intergenic
934550465 2:95258198-95258220 TGCCTCGAGTGGAGCCAAGATGG - Intronic
934811923 2:97286500-97286522 GGCTTTGAGTGGAGCCGTGAAGG + Intergenic
936327193 2:111515553-111515575 TGCTTGGAATGCAGACATGATGG + Intergenic
937202059 2:120210090-120210112 GGCTTGGTGTGGAGAGAAGAAGG + Intergenic
937866737 2:126757744-126757766 TGGTTAGTGTTGAGCCATGATGG - Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
938960491 2:136336249-136336271 TGCTTTGAGTGAAGCCCTGAGGG + Intergenic
940809102 2:158222828-158222850 TACTTGGAGTGGAGCCAAGATGG + Intronic
940841159 2:158583333-158583355 TCCTTGGAGTGGAGGCATAAGGG - Intronic
945139261 2:206666581-206666603 TGTTGGGTGTTTAGCCATGACGG - Intronic
945204075 2:207313141-207313163 TGCTTCGTGTGAAGCCACAAAGG + Intergenic
946537229 2:220644823-220644845 TGCTTGCTGTGGATCTTTGAGGG + Intergenic
947714161 2:232331520-232331542 TGCTGGGTTTGAAGCCATCAGGG + Intronic
947733371 2:232442899-232442921 TGCTGGGTTTGAAGCCATCAGGG + Intergenic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1174400696 20:50274321-50274343 TGCCTGCTGTGGACCCAGGATGG + Intergenic
1176975643 21:15317753-15317775 TGCATGGTGTGAAACCATGTTGG - Intergenic
1179098326 21:38335231-38335253 CACTTGGAATGGAGCCATGAGGG + Intergenic
1179300882 21:40109428-40109450 TCAGTGGTGTGGAGCCAAGATGG + Intronic
1182329904 22:29544167-29544189 TGCTAGGTGTTGAGAAATGATGG - Intronic
1182890814 22:33817488-33817510 TGCTGGGTATGCAGCCATGAAGG - Intronic
1183410393 22:37651675-37651697 TGCTTGGTATGGAGGCACCACGG - Intronic
1185247363 22:49780237-49780259 TGCATGGAGTGGGGCCAGGAAGG + Intronic
949524065 3:4886268-4886290 TGCTTGGGGAGGAGGCACGAGGG - Intronic
951042765 3:18005801-18005823 TGGTTGAGGTGGAGCCAAGATGG - Intronic
951804390 3:26628598-26628620 TAAATGGTTTGGAGCCATGATGG + Intronic
952869189 3:37882930-37882952 TGCTTGGTTTGGAGCCAAGTTGG + Intronic
953534877 3:43769871-43769893 TGCTTGGAATGGAGCCAGGACGG - Intergenic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
954875005 3:53796435-53796457 TGCTTGCTGTGGCGCTGTGAGGG + Intronic
955211422 3:56945128-56945150 TGCCAGGGGTGGAGCCAAGATGG + Intronic
958736203 3:98012005-98012027 TGCTTGGTGGGGTGCCAGGGTGG + Intronic
960081016 3:113540273-113540295 TGAGAGGTGTGGAGTCATGAGGG - Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
962896187 3:139717009-139717031 TGCATGGAGTGGAGACAGGAAGG + Intergenic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964578196 3:158198794-158198816 TGCGGGGGGTGGAGCCAAGATGG - Intronic
968482687 4:843379-843401 TGCTTGCTGGGAAGCCTTGATGG - Intergenic
968544540 4:1192030-1192052 TCCTTGCTGTGGAGAGATGAGGG - Intronic
968553455 4:1236023-1236045 TGCTGGGTGTGGGGCCCTGCCGG - Intronic
968582409 4:1401274-1401296 TGCTCGGTGGGGGTCCATGAGGG - Intergenic
969529575 4:7723330-7723352 TGCTAGGGATGGAGCCAGGAAGG - Intronic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
973713333 4:53650760-53650782 TGCATGCTCTGGAACCATGAGGG - Intronic
974547622 4:63333598-63333620 GGTTGGGTGTGGAGCCAAGATGG + Intergenic
974841200 4:67301109-67301131 TGTTTTGGGTGGAGCCAAGATGG - Intergenic
975379016 4:73677170-73677192 TGCTGGGTCTGGAGCCAGAAAGG + Intergenic
975996496 4:80321758-80321780 TGGTGGGTGTGGAGACAGGAAGG - Intronic
978591328 4:110327936-110327958 TCCTCGGGGTGGAGCCAAGATGG - Intergenic
980680586 4:136155078-136155100 TTCTTGGTGTGGCTCCATGTGGG + Intergenic
981188430 4:141833618-141833640 TTCTTGGGGAGGAGCCAAGATGG + Intergenic
981839558 4:149094716-149094738 TGCCGGGGGTGGAGCCAAGATGG - Intergenic
984815359 4:183831110-183831132 TGGTGGGTGTGGAGGCGTGAGGG + Intergenic
986702657 5:10426531-10426553 TGCTGGTTGTGGAGCCTTGAAGG + Intronic
987216975 5:15747717-15747739 TGCCTGATGTAGAGCCATAAGGG + Intronic
988994434 5:36701109-36701131 AGCTTGATGTGGAGCCAGGCAGG + Intergenic
990131859 5:52595867-52595889 TGCTTAGAGTGGATCAATGAAGG - Intergenic
992280873 5:75175744-75175766 TGGTTGGGGTGGAGCCAAGATGG + Intronic
992471997 5:77067014-77067036 TGCCTGGGTTTGAGCCATGAAGG - Intergenic
993809688 5:92460345-92460367 TGGGTGGTTTGGAGCCATGTTGG - Intergenic
993837655 5:92835123-92835145 TGGATGGTGTGGAGTCAGGAAGG - Intergenic
996199540 5:120654174-120654196 TGCTTGGAATGCAGACATGATGG + Intronic
997561066 5:134846366-134846388 TCCCCGGTGTGGAGCCATTACGG + Intronic
998009723 5:138684809-138684831 TCCTGGGGGTGGAGCCAAGATGG - Intronic
999485233 5:151988902-151988924 TGTTTTGGGTGGAGCCAAGATGG + Intergenic
1000617748 5:163447895-163447917 TGCTTGGAATGCAGCCATGCTGG + Exonic
1003172006 6:3727279-3727301 TGGTTCGTGTGGGGCCCTGAGGG - Intronic
1005639351 6:27781118-27781140 TGCTTGGTGGGGACCCACGTGGG - Intergenic
1006855255 6:37128495-37128517 GACTTGGTGTGAAGCCATGCAGG - Intergenic
1009187071 6:60587108-60587130 TGCTTGTTCTGGAGCCAGGTAGG + Intergenic
1009782006 6:68283869-68283891 ACATTGGTGTGGAGCCAAGATGG + Intergenic
1011323974 6:86129163-86129185 GGGTTGGTTTGGAGCCAGGAGGG + Intergenic
1012093949 6:94934171-94934193 TGCTTATAGAGGAGCCATGAAGG - Intergenic
1012606019 6:101158252-101158274 TTCGTGGGGTGGAGCCAAGATGG - Intergenic
1015876032 6:137823619-137823641 TGCTTGGGGAGAAGCAATGAAGG - Intergenic
1016091297 6:139982573-139982595 TACTTTGTGTGGAGACATCAGGG + Intergenic
1016769895 6:147837538-147837560 TGCGTGGTATGGAGATATGAAGG + Intergenic
1019406911 7:888763-888785 TGTTCTGTGTGGAGCCATGCTGG - Intronic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1026017691 7:66683588-66683610 TGTTGGGTGTGGAGCCTGGAAGG + Intronic
1026025795 7:66742466-66742488 TGTTGGGTGTGGAGCCTGGAAGG + Intronic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1031248766 7:119351469-119351491 GGCCAGGTGTGGAGCAATGAGGG - Intergenic
1031248927 7:119354332-119354354 TGCTTGCAGTAGAGTCATGAAGG + Intergenic
1034780169 7:153871782-153871804 TTTTTGGGGTGGAGCCAAGATGG - Intergenic
1035934083 8:3817859-3817881 TCCTTAGTGTGAAGCCGTGAAGG - Intronic
1036516469 8:9448850-9448872 TGGTTTTTGTGGAGCTATGAAGG - Intergenic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1036745779 8:11408090-11408112 AGCTGGGGGTGGAGCCAAGATGG - Intronic
1038264867 8:26031026-26031048 TGCTTAGTGCAGAGCCATTAAGG + Intronic
1039334386 8:36573949-36573971 TGCTTGGCTTGGAGCCACTAAGG - Intergenic
1039853920 8:41396562-41396584 AGCTTGGTGTGGAGGCCTTAGGG + Intergenic
1040403344 8:47075510-47075532 GTCTTGGGGTGGAGCCAAGATGG + Intergenic
1040464983 8:47686111-47686133 AGCTGGGTGGGGAGCCATGGTGG - Intronic
1040814378 8:51492293-51492315 TTATTGGGGTGGAGCCAAGATGG + Intronic
1043514200 8:80981149-80981171 GGCCTGGGGTGCAGCCATGAGGG - Intronic
1048880031 8:138864371-138864393 TGCTTGGTCTTGAGCCAAGGAGG - Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1051087904 9:13372621-13372643 TGCTTGGTCAGTGGCCATGAAGG - Intergenic
1054333864 9:63785300-63785322 TGCTTTGTGCGGGGCCCTGAGGG - Intergenic
1058755210 9:108077327-108077349 GGCATGGTGTGGAGGCAGGAGGG + Intergenic
1059927560 9:119226446-119226468 TTCTTGGTATGTAGCCATGTGGG - Intronic
1061025550 9:128046728-128046750 TGCTTGGAGTGGAGGCGGGAGGG + Intergenic
1203443618 Un_GL000219v1:34096-34118 TGTTTGGGGAGGAGCCAAGATGG + Intergenic
1203514426 Un_KI270741v1:153005-153027 TGTTTGGGGAGGAGCCAAGATGG + Intergenic
1186590930 X:10929208-10929230 TGCCTAGTGTGCATCCATGAAGG + Intergenic
1186647801 X:11525703-11525725 TGCTAGGAGTGGAGCACTGAAGG + Intronic
1188276363 X:28206286-28206308 ATCTTGGTGTGGAACCAAGAAGG + Intergenic
1188289317 X:28368203-28368225 TTCTGGGGGTGGAGCCAAGATGG - Intergenic
1190975481 X:55396510-55396532 AGGTTGGGGTGGAGCCAAGATGG + Intergenic
1191203577 X:57810626-57810648 TGCTGGAGGTGGAGCCAAGATGG - Intergenic
1192087519 X:68115597-68115619 TGCTTTGTGTGCAGCATTGAGGG + Intronic
1192738911 X:73874758-73874780 TGTCTGGTGGGGAGCCATGGAGG - Intergenic
1195739975 X:108054227-108054249 TGTTTGGTGTGTACCCATTAAGG - Intronic
1196112536 X:111962835-111962857 TGCCGGGGGTGGAGCCAAGATGG + Intronic
1199272343 X:145898843-145898865 GGCTTGGTGTGGATCTCTGACGG - Intergenic
1199595546 X:149503760-149503782 TGCTGGGGGCAGAGCCATGAGGG + Intronic
1199598330 X:149525451-149525473 TGCTGGGGGCAGAGCCATGAGGG - Intronic
1200833581 Y:7711250-7711272 TTCTTGGGGTGGAGCCAAGATGG - Intergenic