ID: 954198903

View in Genome Browser
Species Human (GRCh38)
Location 3:49012716-49012738
Sequence GACCAGGAGCTGCCTCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954198903_954198913 13 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198913 3:49012752-49012774 ATTGTGTGCTATGGCCAATGGGG 0: 1
1: 0
2: 0
3: 7
4: 119
954198903_954198906 -10 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198906 3:49012729-49012751 GCTCCTGGTCCCGAGGGCTTCGG 0: 1
1: 0
2: 3
3: 22
4: 186
954198903_954198914 17 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198914 3:49012756-49012778 TGTGCTATGGCCAATGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 147
954198903_954198910 4 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198910 3:49012743-49012765 GGGCTTCGGATTGTGTGCTATGG 0: 1
1: 0
2: 1
3: 4
4: 83
954198903_954198911 11 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198911 3:49012750-49012772 GGATTGTGTGCTATGGCCAATGG 0: 1
1: 0
2: 0
3: 9
4: 99
954198903_954198912 12 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198912 3:49012751-49012773 GATTGTGTGCTATGGCCAATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
954198903_954198916 28 Left 954198903 3:49012716-49012738 CCTGCTGGAGGCAGCTCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 309
Right 954198916 3:49012767-49012789 CAATGGGGAAGGTCGTGTCAAGG 0: 1
1: 0
2: 1
3: 1
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954198903 Original CRISPR GACCAGGAGCTGCCTCCAGC AGG (reversed) Exonic
900086292 1:899322-899344 GGCCAGAAGGTGCCCCCAGCCGG - Intergenic
900294356 1:1941449-1941471 GACCAGGGGATGCAGCCAGCAGG + Intronic
900743845 1:4346793-4346815 GACCAAGAGCTCCCAACAGCTGG + Intergenic
901125233 1:6924388-6924410 GACCTTGAGCAGCCTCCTGCAGG + Intronic
901240099 1:7687866-7687888 GCCCTGGAGCTGTCTCCACCAGG - Intronic
901332697 1:8423526-8423548 AGCCAGGAGCTGCCCCCACCGGG - Intronic
901494979 1:9615614-9615636 CATCAGGAGCTTCCTGCAGCGGG + Intergenic
901634732 1:10665229-10665251 GGCCTGGAGCTGCCTCCCGAGGG - Exonic
902322923 1:15681603-15681625 GAACCAGAGCTGCATCCAGCAGG + Intergenic
903002897 1:20279057-20279079 GGCCTGGGGCTGCCGCCAGCTGG + Intergenic
903384845 1:22919541-22919563 GGCCAGGCGGGGCCTCCAGCTGG + Intergenic
903555045 1:24187188-24187210 TACCTGGAGCGGCCTGCAGCAGG + Exonic
903692395 1:25183776-25183798 GCCCAGAAGCTGCCTCCAATAGG - Intergenic
905563821 1:38947653-38947675 GACCAGAAGATGATTCCAGCAGG + Intergenic
905664269 1:39753145-39753167 GGCCAGGGGCTGTGTCCAGCGGG + Intronic
909062127 1:70891197-70891219 GACCATGAGCTTCCAGCAGCAGG + Intronic
913212889 1:116596123-116596145 GATCAGCAGGTGGCTCCAGCAGG + Intronic
915312249 1:155010608-155010630 GCCCAGGAGCTGCAGCCATCTGG - Intronic
917334817 1:173916222-173916244 GGGCAGGGGCTGCCTCCAGCTGG + Intronic
918972083 1:191432900-191432922 GCACAGGAGCTGCAGCCAGCAGG + Intergenic
919806360 1:201383077-201383099 GAGCAGAACCAGCCTCCAGCCGG - Exonic
920099532 1:203508327-203508349 GTCCAGGGCCTGCCCCCAGCAGG + Intronic
920555750 1:206903067-206903089 GACCAGGACCTCCCTCCCCCTGG + Exonic
920965457 1:210697384-210697406 GACCCCGTGCTGCCTCCTGCAGG + Intronic
922544575 1:226446365-226446387 GACCATGAGCTGGTTCTAGCTGG + Intergenic
922706435 1:227793131-227793153 GTCCCTGAGTTGCCTCCAGCTGG - Intergenic
922798511 1:228353291-228353313 ACACAGGTGCTGCCTCCAGCAGG - Intronic
922913985 1:229240737-229240759 GACCAGGTGCTGGCTGGAGCAGG - Intergenic
1062825578 10:565959-565981 TCCAAGGTGCTGCCTCCAGCAGG - Intronic
1067319955 10:45208836-45208858 TACCAGTTGCTGGCTCCAGCAGG - Intergenic
1067808369 10:49408657-49408679 GACCAGGGGCTGCCTATTGCTGG - Intergenic
1069061682 10:63901421-63901443 GACCAGCAGCTGCCCCCTTCAGG - Intergenic
1070097470 10:73351961-73351983 AATGAGGAGCTGCCTCCATCAGG - Intronic
1070800480 10:79242318-79242340 GACCAGGAGCTGGCGGCAGGAGG - Intronic
1072802176 10:98399946-98399968 GATCAAGAGCTGCCACCAACTGG + Intronic
1075335684 10:121607477-121607499 GACCAGGAGCTGCTTCCAGGGGG - Intergenic
1075608173 10:123831369-123831391 GAGCAGGCACTGCCTACAGCTGG + Intronic
1075945716 10:126431447-126431469 GACCTGGTGCTGCCTGGAGCAGG - Intronic
1077104741 11:837288-837310 GACCAAGCGCTACCACCAGCCGG + Exonic
1077307676 11:1875271-1875293 GTCCAGGCGCTGCCTCCTCCAGG + Intronic
1077344131 11:2038632-2038654 GTCAAGGGGCTGCCACCAGCTGG - Intergenic
1079680308 11:23288087-23288109 GATCATCAGCTGACTCCAGCTGG + Intergenic
1081705976 11:45181998-45182020 GCCCAGGAGCTGCCGGGAGCAGG - Intronic
1081759928 11:45570032-45570054 GACCTGCAGCTGCCTGCAGATGG - Intergenic
1082641036 11:55661883-55661905 GACCAGGGGCTACTCCCAGCAGG - Intergenic
1083397074 11:62399601-62399623 GGCCAGGGTCTGCCTGCAGCGGG + Intergenic
1083610215 11:64000762-64000784 GACCAGTCGCTGCCTCCGCCCGG + Intronic
1084006745 11:66327086-66327108 TCCCAGGGGCTGCGTCCAGCAGG + Intergenic
1085728404 11:78975268-78975290 GCCCACGCGCTGCCTCCAGAGGG + Intronic
1086395956 11:86415215-86415237 GGTTAGCAGCTGCCTCCAGCTGG - Exonic
1087775552 11:102253561-102253583 GATCCAGAGCTGCCTGCAGCTGG - Intergenic
1088154211 11:106783935-106783957 TAACAGGGGCTTCCTCCAGCTGG - Intronic
1088314993 11:108498348-108498370 GACCATGCGCCGCCTCCCGCGGG - Exonic
1088357466 11:108958999-108959021 TACCAAGTGGTGCCTCCAGCCGG - Intergenic
1089128172 11:116191924-116191946 GACCAGGGACTGCCCACAGCAGG - Intergenic
1089337597 11:117735733-117735755 GGCCCGGAGCTGCGTCCAGCGGG + Intronic
1090186043 11:124739866-124739888 AATCAGGAGCAGCCTCCGGCAGG - Exonic
1090332150 11:125940604-125940626 GACCAGAAGCTGCTTTCACCAGG - Intergenic
1091223779 11:133946004-133946026 ACCGAGGAGCTGACTCCAGCTGG + Intronic
1202827117 11_KI270721v1_random:93821-93843 GTCAAGGGGCTGCCACCAGCTGG - Intergenic
1091702747 12:2674618-2674640 GACCAGGTGGTGCCCCCTGCAGG + Exonic
1091968639 12:4766714-4766736 GAGCAGTAGCTCCCTCCAGGAGG - Intronic
1092032660 12:5301216-5301238 TAACAGCAGCTGCCTGCAGCAGG + Intergenic
1092158066 12:6297475-6297497 GACCAGGAGTTGAGACCAGCCGG - Intergenic
1093228363 12:16513466-16513488 CACCAGGAGCTGGCTCTGGCAGG - Intronic
1099304386 12:80936936-80936958 GACCGGGAGCTGCCGGCGGCGGG + Intronic
1100831031 12:98516431-98516453 GACCACCAGCCGCCTGCAGCGGG + Intronic
1101908626 12:108846422-108846444 AGCCAGGAGCTGCTGCCAGCAGG + Intronic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1104361599 12:128138291-128138313 GACAAGGAGCTGAGTCTAGCTGG + Intergenic
1105440598 13:20412738-20412760 GGCCAGACGCTGCCTCCAGAAGG - Intronic
1106922040 13:34574241-34574263 GACCAGTAGCTGCAGTCAGCTGG + Intergenic
1108275609 13:48806510-48806532 GGCCAAGAGCTGCCTCAAGAAGG - Intergenic
1110168863 13:72475820-72475842 CACCAGGATCAGCCTCAAGCAGG + Intergenic
1111436528 13:88216956-88216978 GATCAGGATCTGGCTCCGGCTGG + Intergenic
1111929892 13:94502387-94502409 GACACGGACCTTCCTCCAGCAGG + Intergenic
1112450288 13:99501672-99501694 GGCCAGGAACCGCCCCCAGCAGG - Exonic
1113067841 13:106389934-106389956 GCTAAAGAGCTGCCTCCAGCAGG + Intergenic
1113715472 13:112503100-112503122 TGGCAGGGGCTGCCTCCAGCTGG - Intronic
1113778971 13:112965216-112965238 GACCAGGACCTGCTTGCTGCTGG + Intronic
1114633406 14:24173616-24173638 GGACAAGAGCTGCCTCCAGTGGG - Intronic
1115946305 14:38665253-38665275 CACCAGGAGCTGCCAGGAGCTGG - Intergenic
1116678098 14:47931474-47931496 GATCTGGAGTTGCATCCAGCTGG + Intergenic
1119866842 14:77981246-77981268 GCGCAGGAGCAGCCTCCACCTGG + Intergenic
1121015534 14:90546635-90546657 GAGCAGGAGCTGCGTGCTGCTGG - Intronic
1121358560 14:93234716-93234738 GGCCAGCAACTCCCTCCAGCTGG + Intergenic
1121458134 14:94052251-94052273 GACCAGGAGTTTTCTCAAGCAGG + Intronic
1122231645 14:100309052-100309074 GACAGGGGGCTGCCTTCAGCTGG + Intergenic
1122409114 14:101517089-101517111 TCCCAGGTGCTGGCTCCAGCAGG + Intergenic
1122597622 14:102904087-102904109 TCCCAGGAGCTCCCACCAGCGGG + Intronic
1124376588 15:29132767-29132789 GTCCAGAAGCTACTTCCAGCAGG + Intronic
1124692316 15:31834573-31834595 TTCCAGGAGCTGCCTCTTGCTGG + Intronic
1127274295 15:57428618-57428640 AGGCAGGAGCTGCCTCCAGTAGG + Intronic
1127467595 15:59259295-59259317 GACCAGGAGATGCCAGCAGGAGG - Intronic
1128280085 15:66387217-66387239 GCCCCGGGGCTGCCTTCAGCGGG - Exonic
1132486053 16:191924-191946 GACAATGAGCTGTCTCCAGGAGG + Intronic
1132721849 16:1320536-1320558 GGGGAGGAGCTGCCACCAGCGGG - Intronic
1132749495 16:1450907-1450929 AAGCAGGAGCCGCGTCCAGCGGG + Intronic
1132801738 16:1757989-1758011 GAGAGGGAGCAGCCTCCAGCAGG - Intronic
1132943396 16:2519535-2519557 CCCCAGGAGCTTCCTCCAGCTGG + Exonic
1132999065 16:2840129-2840151 GACCAGGAGCTGCAGTCACCTGG + Intergenic
1133058317 16:3158528-3158550 GACCAGGGGCTGCGGCCCGCGGG - Intergenic
1133235403 16:4385172-4385194 CACCAGGTGCTGACTGCAGCAGG + Intronic
1134644695 16:15857059-15857081 GACCCGGAGCTGCCCGCGGCTGG + Intergenic
1136025204 16:27464337-27464359 GGCCAGGCGCAGCCTCCAGAGGG - Exonic
1136568737 16:31084626-31084648 CCCCAGGAGCTGCATGCAGCCGG + Exonic
1137250592 16:46737836-46737858 GACAAGGAGCATCGTCCAGCAGG - Exonic
1137769665 16:51005816-51005838 GACCAGAAGCAGACCCCAGCTGG - Intergenic
1138561334 16:57802434-57802456 GGCGTGGAGCTGCCTCCTGCCGG - Exonic
1140124883 16:72110850-72110872 AACCAGGTGCTGCATCCACCAGG - Intronic
1140467487 16:75194155-75194177 GCCCAGGAGCAGCCTGCAGAAGG + Intergenic
1141376205 16:83533166-83533188 GACCAGCAGATGCCAGCAGCTGG + Intronic
1141598276 16:85110542-85110564 AAACAGGAGCTGCCACCAGCCGG + Intronic
1141832308 16:86516656-86516678 GAGCAGGAGCTGCTTGGAGCAGG + Intergenic
1142355758 16:89601037-89601059 GTCCAGGGACTGCCTGCAGCAGG + Intergenic
1143410534 17:6705753-6705775 GACCAGCAGCTGACTCCTGATGG + Intronic
1143683204 17:8492859-8492881 GACCAAGAACCGCCTGCAGCAGG - Exonic
1143725169 17:8839584-8839606 GACCAGCTGCTGCTGCCAGCTGG + Intronic
1144312485 17:14025513-14025535 GACCAGGAGGTGGCTCCAAAGGG + Intergenic
1144332267 17:14235812-14235834 GACCAGGAGGTGGCTCCAAAGGG - Exonic
1144498558 17:15765711-15765733 GACCAGGAGGTGGCTCCAAAGGG + Intergenic
1145161940 17:20580751-20580773 GACCAGGAGGTGGCTCCAAAGGG + Exonic
1146398599 17:32487140-32487162 GCGCAGGAGCTGCCGCCTGCCGG + Exonic
1146656104 17:34636177-34636199 GACCTTGAGCTTCCTCAAGCAGG + Exonic
1147332520 17:39707162-39707184 AGCCAGGCCCTGCCTCCAGCTGG + Intronic
1147363309 17:39944656-39944678 GACCAGGCGCTCCCTCAAGCGGG + Exonic
1148333285 17:46824897-46824919 GACCCTGTGCTGCCTCCAGTGGG + Intronic
1151261272 17:72917871-72917893 GACCACCAGCTACCTACAGCAGG + Intronic
1151527504 17:74681071-74681093 CCCAAGGAGCTGCGTCCAGCAGG + Intronic
1152561535 17:81081278-81081300 GCCCTGGAGCTGCCTCCCCCGGG + Intronic
1152764283 17:82127654-82127676 CCCCAGGAGCTGCCCACAGCTGG - Intronic
1152965323 18:109193-109215 GACTAGGATCTGCCTACAGGAGG + Intergenic
1153715915 18:7847821-7847843 GACAAGCAGATGCCACCAGCTGG - Intronic
1153947798 18:10032495-10032517 GCCCAGGAGCGGCCTTCCGCTGG - Intergenic
1154024746 18:10696684-10696706 GAACAGGAGCTGTCCACAGCGGG - Intronic
1154490245 18:14916474-14916496 GAGAGGGAGATGCCTCCAGCTGG + Intergenic
1155495176 18:26435792-26435814 CACCTGGAGATGCCTCCAACAGG - Intergenic
1155740192 18:29279802-29279824 GGATAGGAGCTGCCTCCAGAAGG + Intergenic
1156338400 18:36188882-36188904 GGTGAGGAGCTGTCTCCAGCAGG - Intronic
1156488927 18:37485235-37485257 GAGCGGGAGCTGCCTCCGCCGGG - Intronic
1157607202 18:48933322-48933344 GACTAGGAGTTGCCTCTACCTGG - Intronic
1157901495 18:51522590-51522612 CACCAGGAGCCGCCCGCAGCTGG - Intergenic
1160006245 18:75071170-75071192 GACCTGCAGCTTCCACCAGCAGG + Intergenic
1160125738 18:76169723-76169745 GACCAGGTCCAGCCTCCTGCGGG + Intergenic
1160870681 19:1276367-1276389 GCCCAGGGGCTGCCTACAGCTGG - Intronic
1160871502 19:1279868-1279890 GAGGAGGAGCTGCCACCAGGTGG + Intergenic
1161105329 19:2441039-2441061 AACCAGGAGCTGCCCCAGGCTGG + Intronic
1161123101 19:2540923-2540945 GACCAGGAGCCGCCGCCGCCAGG + Intronic
1161165295 19:2783515-2783537 GAACAGTGGCTGACTCCAGCCGG + Intergenic
1161394072 19:4035418-4035440 AACCAGGGCCTGCCTCCAGTTGG + Intronic
1161551764 19:4916869-4916891 GATCAGGAGGGACCTCCAGCCGG - Intronic
1161747586 19:6070376-6070398 GACCAGGACCCCCCTCCAGAAGG - Intronic
1161802096 19:6421939-6421961 GGACAGGACCTGCCTCTAGCAGG + Intronic
1161803925 19:6431403-6431425 GAACTGGAGCTACCTCAAGCAGG - Intronic
1162487280 19:10968921-10968943 ACCCAGGAGATGCCTCCAGGAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163236978 19:16035597-16035619 GGCCACGGGCTGCCTCCAGAGGG - Intergenic
1163689640 19:18731646-18731668 TACCTTGTGCTGCCTCCAGCTGG + Intronic
1163821778 19:19500153-19500175 TGTCAGGAGATGCCTCCAGCAGG - Intronic
1163862907 19:19751531-19751553 GGCCACGAGCTGCTTCCAGGAGG + Intergenic
1164511794 19:28903682-28903704 GGCAAGTACCTGCCTCCAGCTGG - Intergenic
1164742059 19:30583190-30583212 GACCAGGAACTCCTTCCAACAGG - Intronic
1165466580 19:35978470-35978492 GAGCAGGAGGTGCGGCCAGCAGG - Intergenic
1165483873 19:36083570-36083592 CACCAGGACCCTCCTCCAGCTGG - Intronic
1166254455 19:41592375-41592397 GGGCAGGAGCTGCCTGCAGAGGG - Intronic
1166269809 19:41707052-41707074 GGACAGGAGCTGCCTGCAGAGGG - Intronic
1166392967 19:42420184-42420206 GCCCTGGAGCTGCCCCCTGCTGG - Intronic
1166416244 19:42596454-42596476 GGGCAGGAGCTGCCTGCAGAGGG + Intronic
1166735112 19:45079398-45079420 GACCAGAACGTCCCTCCAGCCGG - Intronic
1167660179 19:50791753-50791775 CACCGGGATCGGCCTCCAGCGGG - Exonic
1167772443 19:51529807-51529829 GTCCTGGAGCTGCCTCAAGTAGG - Exonic
1168214000 19:54912024-54912046 TCCCAGGAGCTTCATCCAGCAGG - Intronic
1168500153 19:56886050-56886072 CACCCGGGGCTGCCTTCAGCAGG - Intergenic
1168638872 19:58017438-58017460 GAGCAGGGGCTGCCTCAGGCAGG + Intergenic
924992295 2:322614-322636 GACCAAGAGCTCCCTGGAGCAGG - Intergenic
925076861 2:1023835-1023857 GTCCAAGAGCAGCCTGCAGCCGG - Intronic
925284155 2:2705046-2705068 GACCAGGAGCCGTGTGCAGCAGG - Intergenic
926920101 2:17931725-17931747 GACAAGGAGCGGCAGCCAGCCGG - Exonic
927191467 2:20519856-20519878 GATCAGCAGCAGCCTCCACCGGG + Intergenic
927198228 2:20562707-20562729 GACTAGAAGCTGTCTCCAGGGGG + Intronic
928904654 2:36356324-36356346 GACCAGGAGGTGCCCGCAGCCGG - Exonic
932085237 2:68751840-68751862 GGCCAGGACCAGCCTTCAGCAGG - Intronic
932419666 2:71594106-71594128 GAGCCGGAGCTGCCCACAGCTGG + Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
935337582 2:102031403-102031425 GAAAAGGAGCTGACTGCAGCCGG + Intergenic
937318710 2:120948135-120948157 AAGCAGGAGCTCCCTCCAGCGGG - Intronic
938901636 2:135803502-135803524 GACCATGAGCAGCCTCCTGTTGG + Intronic
940038199 2:149331088-149331110 GCCCAGGAACTCCCTCCGGCTGG - Intronic
942479809 2:176372813-176372835 GACCAGGAGTTCCCTGGAGCAGG - Intergenic
942502458 2:176605867-176605889 GACCAGGACCTGTGTGCAGCAGG + Intergenic
946665755 2:222048004-222048026 GACCAGCAGCTGCCTGGATCTGG - Intergenic
947749146 2:232523790-232523812 GGCCAGAAGCTCCCTGCAGCTGG - Exonic
948712408 2:239833347-239833369 CTCCAGGGGCTGCCACCAGCTGG - Intergenic
1168841455 20:912548-912570 CCCCAGGAGCTGGCTCCAGATGG + Intronic
1170614384 20:17937185-17937207 GAGCTGCAGCTGCATCCAGCTGG + Intergenic
1171354246 20:24531958-24531980 TAACAGAGGCTGCCTCCAGCAGG + Intronic
1171361717 20:24590658-24590680 GACCAGGGGTTTCCTGCAGCCGG + Intronic
1171412045 20:24953915-24953937 ACCCAGCAGCAGCCTCCAGCGGG + Intronic
1172118224 20:32583939-32583961 GCGCAGGAGCAGCCTCCCGCGGG - Intronic
1172759738 20:37313758-37313780 GAGGAGGGGCTGCCCCCAGCTGG + Intronic
1172845140 20:37925700-37925722 GGCCAGGAGCTGCCTACGGGCGG - Intronic
1173523599 20:43716262-43716284 CACCAGGAGCCGCCCACAGCTGG - Exonic
1173646951 20:44639328-44639350 GTCCTGGAGCTCCCTCCAGGAGG + Intronic
1175543979 20:59766229-59766251 GGCCAGGAGCTTCCTCCTGCAGG - Intronic
1176301958 21:5102705-5102727 GCCCAGGCGCTGCCAGCAGCAGG - Intergenic
1176874797 21:14116971-14116993 CTCCAGCAGCTGCCTCCAGAGGG + Intronic
1179460820 21:41533800-41533822 GCCCAGCAGCCCCCTCCAGCTGG - Intergenic
1179521449 21:41948262-41948284 GACCAGGGCCTGCCCCGAGCCGG + Intronic
1179614169 21:42571003-42571025 GACCAGGACCTGACTCCTCCAGG + Intronic
1179819422 21:43928077-43928099 GTCCGGGAGCTGCGTCCGGCTGG - Intronic
1179855072 21:44159195-44159217 GCCCAGGCGCTGCCAGCAGCAGG + Intergenic
1181052140 22:20242994-20243016 GACGACAAGCTGCCCCCAGCAGG - Exonic
1181309773 22:21938304-21938326 GAGCAGCAGCTGCCACCGGCCGG + Intronic
1182077621 22:27505698-27505720 GACCAGGACCTACCTGCTGCAGG + Intergenic
1182353733 22:29712865-29712887 GCCCAGGTGCTGCCTCCTGTGGG + Intergenic
1184271797 22:43388664-43388686 GACCTGGAGCTGGCTCTAGAGGG - Intergenic
1184778160 22:46633516-46633538 GGCCAGGAGCAGCCTTCATCAGG - Intronic
1184914889 22:47562626-47562648 GACCAGGGGCTGCCTGCAGAGGG + Intergenic
1185074481 22:48675978-48676000 AAGCAGGTGCTGCCTCCAGAAGG + Intronic
1185180183 22:49355505-49355527 GAACAGGCGCTCCCTCCCGCAGG + Intergenic
949808052 3:7976913-7976935 GAACACGAGCTGCCTGCAGACGG + Intergenic
951710014 3:25577632-25577654 ACCCAGGAGCTGCCTCCAGTGGG + Intronic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
959863618 3:111242573-111242595 AAAAAGGAGCTGCCTCCTGCAGG - Intronic
962676408 3:137761633-137761655 GGCCTGGTGCTGTCTCCAGCAGG - Intergenic
964435170 3:156643667-156643689 GTAAAGGAGATGCCTCCAGCCGG - Intergenic
964828196 3:160853046-160853068 TGCCAGAAGCTACCTCCAGCTGG - Intronic
966161953 3:176977978-176978000 GACCTGGAGCTTCTTCCAGGTGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
967305218 3:188052590-188052612 TACCCTGTGCTGCCTCCAGCAGG - Intergenic
968360635 3:198144517-198144539 GAGCATGAGCTGCATCCAACAGG - Intergenic
968570900 4:1340266-1340288 GGGCAGGAGTGGCCTCCAGCCGG - Intergenic
968577815 4:1376134-1376156 GGCCAGGAGCTCCCCACAGCCGG + Exonic
969137486 4:5042408-5042430 GACCTGGAGCTGACTTCATCTGG + Intergenic
969394068 4:6909555-6909577 GGCGAGGAGCTGCCTTGAGCGGG - Intronic
969600942 4:8176074-8176096 CCCCAGGAGCTGCATCCACCTGG - Intergenic
971153418 4:24058012-24058034 CACCAGGGGCTGTTTCCAGCAGG - Intergenic
971250466 4:24969744-24969766 GAGCTGGAGCAGCCACCAGCAGG - Intronic
971301072 4:25442862-25442884 CAGCAGGAGCTGCCTCCCGATGG + Intergenic
971379787 4:26086116-26086138 GGCCAGGAGCAGTCTCCTGCAGG - Intergenic
975473216 4:74794048-74794070 GTCTAGGGACTGCCTCCAGCAGG + Intronic
975811879 4:78178083-78178105 GGCCAGGAGCTGCCTGAAGCTGG - Intronic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985617538 5:932666-932688 GAGCAGGAGCTGTGTTCAGCTGG + Intergenic
985712413 5:1436885-1436907 CACCAGAGGCTTCCTCCAGCGGG - Intronic
985725991 5:1515901-1515923 GTCCAGGGGCTCCCTGCAGCTGG - Intronic
985771741 5:1816147-1816169 GAGCCTGAGCTGCCTCCTGCCGG + Exonic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
985862887 5:2488192-2488214 GACCAGGCTGAGCCTCCAGCAGG + Intergenic
986361068 5:6978669-6978691 GACCGGGGGCTGCCTGCAGTTGG + Intergenic
991991752 5:72346471-72346493 GAACAGGAGCTACCTGCAGCAGG - Intronic
995492520 5:112707804-112707826 CAGCAGGAGCTGCGTCCGGCAGG + Intronic
997030273 5:130119529-130119551 GACCAGGTGCTGCTGCCAGTGGG - Intronic
997120208 5:131165400-131165422 GACCAGGAACTTCCCCAAGCCGG - Exonic
997432112 5:133847853-133847875 GACCAAGAGGTGGTTCCAGCAGG - Intergenic
998733509 5:145108089-145108111 CACCAAGAGCAGCCTCCAACTGG - Intergenic
999130296 5:149277885-149277907 GACCAGGAGAAGCCTCCATAGGG - Intronic
999171355 5:149597934-149597956 CATCAGGAGCCGCCTCCAGCAGG + Exonic
999179509 5:149659205-149659227 CATCAGGAGCTGCTACCAGCTGG + Intergenic
1001280300 5:170381873-170381895 GGGTAGGAGCTGCCTCCAGTGGG + Intronic
1001997893 5:176176595-176176617 AACTAGGAGCTGGCTCCAGATGG - Intergenic
1004122117 6:12833904-12833926 CACCAGTAACTCCCTCCAGCTGG + Intronic
1004269721 6:14184020-14184042 GCCCATGAGCTGCCTCTTGCAGG - Intergenic
1004319492 6:14621435-14621457 GATCAAGAGCCACCTCCAGCAGG + Intergenic
1006453441 6:34118681-34118703 GCCCAGAAGCCGCCTACAGCAGG + Intronic
1006522720 6:34581333-34581355 AAACAGGAACTGACTCCAGCTGG - Intergenic
1007947292 6:45837946-45837968 AACCAGGAGCTCCCTGCAGGAGG + Intergenic
1010554723 6:77265167-77265189 TAGCAGGTGCTGCCTCCTGCTGG + Intergenic
1012417294 6:99024654-99024676 GACTACGTGCTGCATCCAGCTGG - Intergenic
1013151205 6:107448067-107448089 GTCCAGAAGCTGCATACAGCAGG + Intronic
1013282961 6:108656019-108656041 GACCAGGAGACGCCTGCAGTCGG + Intronic
1014940846 6:127436906-127436928 GAACAGGAGATGCCTCCAGATGG - Intergenic
1015227844 6:130878752-130878774 GACCAGGATCAACCCCCAGCTGG + Intronic
1015910134 6:138161706-138161728 GACCAGGCGCTCCCTCCCGGCGG + Intergenic
1017690159 6:156956142-156956164 GCACAGGGGCTGCCTCTAGCAGG + Intronic
1018689205 6:166330744-166330766 GGCCAGCCTCTGCCTCCAGCAGG - Intronic
1019134411 6:169899248-169899270 TTCCAGAAGGTGCCTCCAGCAGG - Intergenic
1019259370 7:72115-72137 GAGCATGAGCTGCATCCAACAGG + Intergenic
1019593326 7:1846587-1846609 GACCAGGAGCTGCCCCCACAAGG + Intronic
1020242001 7:6402232-6402254 CCCCAGGAGCTGCCTCCCGCTGG + Intronic
1020763159 7:12291865-12291887 ACCCCGGAGGTGCCTCCAGCTGG + Intergenic
1021437617 7:20638526-20638548 GATAAGGAGTTGCCTCAAGCTGG - Intronic
1021558624 7:21946194-21946216 GTCCCGGCGCAGCCTCCAGCTGG + Intergenic
1022258471 7:28682212-28682234 CACCTGGAGCTGACTTCAGCAGG + Intronic
1022522318 7:31016328-31016350 GTCAAGGAGCTGCCTCTACCTGG - Intergenic
1023038887 7:36155012-36155034 GACCTGGACCTGCCGCCAGGGGG + Exonic
1024012234 7:45278800-45278822 CACCAGGAGCTGCTCCCAGGAGG + Intergenic
1025722177 7:64026988-64027010 GCCCAGGTGCTGCCTTCAGGAGG - Intergenic
1027779796 7:82507337-82507359 GGAGAGAAGCTGCCTCCAGCAGG - Intergenic
1028567326 7:92246761-92246783 GACAAGGAGATGCATCCAGATGG - Intronic
1028925804 7:96355809-96355831 GAGTAGGAGTTGCCACCAGCAGG - Intergenic
1029159237 7:98540035-98540057 GACCAAGTGCTGCCTCCTTCAGG + Intergenic
1032805501 7:135350146-135350168 CAACATGGGCTGCCTCCAGCTGG + Intergenic
1033640296 7:143256768-143256790 GACTAGGAGATGCCCCAAGCTGG - Intronic
1033656993 7:143381317-143381339 GGTCCGGAGCAGCCTCCAGCCGG - Exonic
1034531083 7:151696915-151696937 GACCAGGCGCTGCCACCTGCAGG + Intronic
1034629040 7:152516403-152516425 GCCCTGGAGCCGCCTCCACCTGG + Intergenic
1035257721 7:157642484-157642506 GACCAGAGGCCGCCTCCATCTGG - Intronic
1035335233 7:158123803-158123825 GATCGGGAAGTGCCTCCAGCAGG + Intronic
1035344000 7:158186447-158186469 GACCAGGAGACACCTCCTGCAGG - Intronic
1035401738 7:158570220-158570242 GCCAAGGAGCGGCCTCCAGAAGG - Intronic
1035561968 8:611887-611909 GCCTAGGAGCTGACACCAGCCGG + Intergenic
1036761100 8:11509019-11509041 GGCCATGAGCTGCATGCAGCTGG + Intronic
1037643371 8:20769067-20769089 GATCAGGAGATGCCTGCAGAAGG - Intergenic
1037890313 8:22620623-22620645 GAGCAGCAGCACCCTCCAGCAGG - Exonic
1041200970 8:55451814-55451836 GACCATGAGCAGCCTCCTGGTGG - Intronic
1047741416 8:127809976-127809998 GACCAGTAGCTTCCTCTGGCAGG + Intergenic
1048223412 8:132563760-132563782 AGCCAGGAGCTTCCTGCAGCAGG - Intergenic
1048237150 8:132701860-132701882 GCCTAGGAGCTGCCACCATCTGG - Intronic
1048294268 8:133202984-133203006 GAACAGAAGCTGCTTCCAGCAGG + Intronic
1049225555 8:141448955-141448977 GACAAGCTGCTGCCTGCAGCAGG - Intergenic
1049557279 8:143289393-143289415 ACCCAGGAGGGGCCTCCAGCAGG - Intergenic
1053503769 9:38622368-38622390 CACAAGGAGCTGCATCCAGCAGG - Intergenic
1058868519 9:109183065-109183087 CCCCTGGAGCTGCCTTCAGCGGG + Intronic
1059545152 9:115168395-115168417 GAGCATAAGCTGCCTCTAGCGGG + Intronic
1060551274 9:124486499-124486521 GCCCAGGAGCTGGGTCAAGCTGG + Intronic
1060757955 9:126226415-126226437 GCCGAGGAGCTGCCTGAAGCTGG + Intergenic
1061070102 9:128304359-128304381 GACCAGGAGGAGCCTCCTGAAGG + Intergenic
1061481213 9:130898575-130898597 TTCCAGGAGCTGCCTCAGGCTGG + Intergenic
1062073671 9:134572772-134572794 GCCCAGGACCTGCATGCAGCAGG - Intergenic
1062745336 9:138208348-138208370 GAGCATGAGCTGCATCCAACAGG - Intergenic
1185713906 X:2326145-2326167 CATCAGGTGCTGGCTCCAGCAGG - Intronic
1190301284 X:49059019-49059041 GACCAGGCCCTGGCTCCGGCTGG - Exonic
1192784776 X:74325213-74325235 GATCATGAGCTGCCTCCTGGTGG + Intergenic
1196152929 X:112393841-112393863 GGAAAGGAGCTGCATCCAGCGGG - Intergenic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic
1199289032 X:146085657-146085679 TACCAGGTGCTTCATCCAGCTGG - Intergenic
1199861254 X:151801851-151801873 GAGCAGTAGCTGCCATCAGCAGG + Intergenic
1200231038 X:154444022-154444044 GACCAGGGGCGGTCTCCGGCGGG + Intergenic
1201941612 Y:19466408-19466430 GAGCAGCTGCTGCTTCCAGCTGG - Intergenic