ID: 954200776

View in Genome Browser
Species Human (GRCh38)
Location 3:49021953-49021975
Sequence CTGGAGCTGCGCCGGAGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954200757_954200776 29 Left 954200757 3:49021901-49021923 CCCCGGGACTATGGGCAAGGGCC 0: 1
1: 0
2: 0
3: 16
4: 90
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
954200756_954200776 30 Left 954200756 3:49021900-49021922 CCCCCGGGACTATGGGCAAGGGC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
954200759_954200776 27 Left 954200759 3:49021903-49021925 CCGGGACTATGGGCAAGGGCCCG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
954200758_954200776 28 Left 954200758 3:49021902-49021924 CCCGGGACTATGGGCAAGGGCCC 0: 1
1: 0
2: 1
3: 22
4: 254
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
954200769_954200776 8 Left 954200769 3:49021922-49021944 CCCGGGGCGGGGAGGGCGGCAGG 0: 1
1: 0
2: 14
3: 138
4: 1017
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
954200771_954200776 7 Left 954200771 3:49021923-49021945 CCGGGGCGGGGAGGGCGGCAGGT 0: 1
1: 0
2: 6
3: 57
4: 448
Right 954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954200776 Original CRISPR CTGGAGCTGCGCCGGAGGTC GGG Exonic
900364926 1:2307444-2307466 CAGGAGCTGCCCCGGAGCTGAGG + Exonic
900613012 1:3552334-3552356 CTGGGGCTGCGCCTGATGCCAGG + Intronic
901862895 1:12086137-12086159 CTGGAGCTGCGCGGGAACCCAGG + Intronic
904040573 1:27582099-27582121 ATGGAGCTGCGCTGGAGAGCAGG - Intronic
905534059 1:38705216-38705238 CTGGAGCTCAGCGGGAGGTTGGG + Intergenic
911695268 1:100883396-100883418 CTGGAGCTGGGATGGAGGTCAGG - Intronic
915603707 1:156938069-156938091 CTGGAGCGGCGGCTGAGGTGGGG + Intronic
919465942 1:197921673-197921695 CCGGGGCTGCGCCGGGGGTGAGG - Intronic
920496883 1:206461220-206461242 CTGGCGCTGCGCTGGAAGGCGGG - Exonic
920850386 1:209624384-209624406 CTGGAGCTGAGTGGGAGGTGTGG - Intronic
923171602 1:231422069-231422091 CCGGCGCTGCGCCGGAGCTTAGG - Exonic
923366016 1:233262085-233262107 CTGGAGCTGCAGCGGAGGGGAGG + Exonic
1067469688 10:46527560-46527582 CTGGAGCTGAGCCCGGGCTCAGG + Intergenic
1069541205 10:69295249-69295271 CCGGAGCTGCGGCAGAGGCCTGG - Intronic
1073484335 10:103807114-103807136 CTGGAGCTGCGCTGTAAGTCTGG - Intronic
1074882055 10:117667178-117667200 CTGGAGATGAGCAGGAGGTTGGG + Intergenic
1075229927 10:120667228-120667250 CTGGAGCTGAGTCGGAGTTAAGG + Intergenic
1077352617 11:2099925-2099947 CTGGAGCTGCGGCTGAGAGCGGG - Intergenic
1080582679 11:33656914-33656936 CTGGGGCTGCACAGCAGGTCAGG - Intronic
1081667864 11:44927033-44927055 ATGGAGCTGGGGCGGAGGTGGGG - Intronic
1081860907 11:46332972-46332994 CTGGAGCGGAGCCGGAGCCCGGG - Intronic
1083913120 11:65721342-65721364 CTGGAGGATCGCCTGAGGTCAGG - Intergenic
1083987778 11:66227985-66228007 CTGGAGCTGCCCAGGAGTGCAGG + Intronic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1085317462 11:75554294-75554316 CTGGGGCTCGGCCAGAGGTCTGG + Intergenic
1091327916 11:134705741-134705763 TTGGAGCTGAGTGGGAGGTCGGG - Intergenic
1101254548 12:102964812-102964834 CTGGAGCTTCTCGGGAAGTCCGG - Intergenic
1101342560 12:103856232-103856254 CTGGAGCTGGGAGGGAGGTTAGG - Intergenic
1103446705 12:120999597-120999619 CTGGCGCTGAGCCGGTGGGCCGG - Exonic
1104936531 12:132367502-132367524 CAGGGGCTGTGCCGGAGGACTGG - Intergenic
1104951828 12:132444540-132444562 CTGGAGCAACGCTGGAGGCCGGG + Intergenic
1105202215 13:18190521-18190543 CTGGAGCAGTGCCAGAGGTTGGG - Intergenic
1105914483 13:24900419-24900441 CAGGAGCTGGACCTGAGGTCAGG + Intronic
1106410012 13:29504986-29505008 CTGGAGATGCACCTGAGGCCCGG - Exonic
1107708722 13:43132083-43132105 CAGGAGCTGCTCAGGAGGCCAGG - Intergenic
1112693411 13:101919867-101919889 CAGGCGCTGCGCCAGGGGTCGGG - Intronic
1117548585 14:56812166-56812188 CTGGAGCTGCTGCAGAGGGCCGG - Intergenic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1122330808 14:100911226-100911248 CTGCAGCAGCGCCCGAGCTCTGG - Intergenic
1123074593 14:105661639-105661661 CTGGAGCTGCACCAGAGTTGGGG - Intergenic
1125903738 15:43371297-43371319 CTGGAGGTGCGCTGGAGGAGGGG + Exonic
1128072831 15:64807983-64808005 CTGGAGCTGCGGGGGAGGAGTGG + Intergenic
1128635360 15:69299116-69299138 CTGGGGCTGCCGCGGAGGGCGGG - Intronic
1128826073 15:70718593-70718615 CTGGAGCAGAGCCACAGGTCAGG + Intronic
1130335239 15:82952530-82952552 CCGGAGCAGCGCCGGAGATGGGG - Exonic
1131249328 15:90820245-90820267 CTGCAGCAGCCCCGGAGGCCAGG - Intergenic
1131841829 15:96445657-96445679 CTGCTGCTGCGCCGGACTTCAGG + Intergenic
1132339254 15:101067720-101067742 CTGGATCTGCTCCTGAGCTCTGG + Intronic
1132504508 16:300676-300698 CTGGAGCAGAGCCGGGGGACAGG + Intronic
1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG + Intronic
1132647689 16:1006711-1006733 CTGGAGCTGCGCAGGGGACCTGG + Intergenic
1132656119 16:1042678-1042700 CTGGAGCTGGGAGGGAGGTGGGG + Intergenic
1136478500 16:30527154-30527176 CCGGAGCTGACCCGGAGGCCCGG - Intronic
1136544460 16:30947759-30947781 CTGGGGCTGAGCTGGAGGTGGGG + Exonic
1138556156 16:57772345-57772367 CTGGTGCTGGGCAGGAGGCCTGG - Intronic
1141983587 16:87565319-87565341 CTGGAGATGCCCCGCAGGGCTGG - Intergenic
1142015866 16:87746973-87746995 CTGGAGCTGCACACGAGGTAGGG + Intronic
1142727959 17:1830139-1830161 CGGGGGCTGGGCCGGCGGTCCGG + Intronic
1143830370 17:9645874-9645896 CTGGAGCTGGGGCTGGGGTCCGG - Exonic
1144638234 17:16924284-16924306 CTGGAGCTGAGCTGGTGGGCTGG + Intergenic
1145057803 17:19714686-19714708 CTGGAGCTGGGCAGGAAGCCAGG - Intronic
1146489679 17:33271370-33271392 CTGGAGCTCCAGAGGAGGTCAGG - Intronic
1148577774 17:48723515-48723537 CTGGAGCTGCTCCCGAGAACTGG + Intronic
1149994411 17:61399372-61399394 CCGGAGCTGGGTCGGAGGCCAGG + Intergenic
1150969964 17:70016389-70016411 CTGGAGCTGTGACTGAGGTTGGG + Intergenic
1151974675 17:77477654-77477676 CAGGAGCTGGGAGGGAGGTCAGG + Intronic
1151988077 17:77556764-77556786 CTGGAGCTGGGGAGGAGGTGAGG - Intergenic
1152197148 17:78924699-78924721 CTGGAGCTGCGGCGGAATTTCGG + Intronic
1152238450 17:79150139-79150161 CAGGAGCTGCCCTTGAGGTCAGG + Intronic
1152468122 17:80476916-80476938 CTGGAGCCCCGTCGGAGGTTCGG - Intronic
1152630644 17:81409373-81409395 CTGGAGCTGCGCCGGCTGAGTGG + Intronic
1152799791 17:82325505-82325527 CTGGAGCTGAGCGGGTGGCCGGG - Intronic
1154016869 18:10626722-10626744 CTGGAGCTGTGCTCAAGGTCAGG + Intergenic
1154188646 18:12208943-12208965 CTGGAGCTGTGCTCAAGGTCAGG - Intergenic
1154940964 18:21112037-21112059 CTGGAGCGGCCTTGGAGGTCCGG + Intergenic
1157544938 18:48540389-48540411 CTTGGGCTGCGGCGAAGGTCTGG + Intronic
1158699766 18:59735430-59735452 TTGGAGCTGGGCAGGAGTTCAGG + Intergenic
1160427433 18:78787868-78787890 CTGGAGCTGGGCTGGACGTTGGG - Intergenic
1160493125 18:79354602-79354624 GTGGAGCTGGGCCGGAAGTGGGG - Intronic
1160520920 18:79507484-79507506 ATGGTGCTGCCCCGGAGGGCAGG - Intronic
1162125215 19:8495943-8495965 GTGGAGCTGGGCAGGAGGTGCGG + Intronic
1162445283 19:10718829-10718851 CTGGAGCTGCCCCCGCCGTCTGG + Intronic
1163237326 19:16037327-16037349 CTGGAGCTGGGCGGGTGGGCCGG + Intergenic
1164618157 19:29678798-29678820 CCAGAGCTGAGCCTGAGGTCTGG + Intergenic
1164919596 19:32078982-32079004 CTGGAGCTGAGCCTGAGGATGGG - Intergenic
1165157198 19:33795979-33796001 CTGGAGCGGAGCCGGGGGCCAGG - Intronic
1165419371 19:35715474-35715496 CTGGAGCCTGGCAGGAGGTCTGG + Exonic
1165838318 19:38772526-38772548 TGGGAGCTGCCCAGGAGGTCTGG + Intronic
1165841241 19:38790171-38790193 TGGGAGCTGCCCAGGAGGTCTGG - Intronic
1165849016 19:38838365-38838387 GTGGAGCTGCGCAGGCAGTCGGG - Intronic
1165860640 19:38907459-38907481 CTGGAGCTTCTCCTGAGGGCAGG + Exonic
1166181647 19:41113101-41113123 CTGGAGCTGGGCCAGGGCTCTGG - Intergenic
1166218964 19:41353390-41353412 CAGGGGGTGCGCCCGAGGTCTGG + Exonic
1167620415 19:50557064-50557086 GAGGAGCTGCGCCAGGGGTCCGG + Intronic
934866453 2:97817677-97817699 CTGGAGCAGCTACGGAGGTGGGG - Intronic
936105453 2:109620472-109620494 CAGGAGCATCGCCTGAGGTCAGG + Intergenic
937877563 2:126836973-126836995 CAGGAACTGGGCCGGAGGGCTGG - Intergenic
938406862 2:131037590-131037612 CTGGGGCTGCACAGGAGGTGAGG - Intronic
938442376 2:131347446-131347468 CTCGAGAAGCGCCGGGGGTCAGG - Intronic
940666696 2:156618234-156618256 CGAGAGCTGCGCCGGTGGGCTGG + Intergenic
945784427 2:214215295-214215317 CTGGAGGTGAGCCAGAGGTCAGG - Intronic
946466632 2:219917889-219917911 CTGGAGCTGCGGCTGGAGTCAGG + Intergenic
948199490 2:236119577-236119599 CTGGAGCTGGGCCGGGGGTGGGG - Intronic
948381243 2:237551241-237551263 CTGGAGCGGGGACGGAGGGCCGG + Intronic
948813934 2:240500118-240500140 CTGGTGCTGTGCCGCAGGACCGG - Exonic
1168895550 20:1321111-1321133 CCGGAGCTGTCCCGGAGGGCAGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1173459532 20:43232089-43232111 CTGGAGCTGTGTGGGAGGGCTGG + Intergenic
1174061393 20:47835492-47835514 CTGGAGCTGAGCCGGTGGAGAGG - Intergenic
1174070134 20:47893831-47893853 CTGGAGCTGAGCCGGTGGAGAGG + Intergenic
1176198020 20:63846530-63846552 CTGGAGCCGGGCCGGCGGGCCGG + Intergenic
1176286203 21:5020756-5020778 CTGGGCCTGCGGCTGAGGTCCGG - Intergenic
1179638597 21:42731847-42731869 CTGGAGCAGCCCCGGAGGGAAGG + Exonic
1179870978 21:44242719-44242741 CTGGGCCTGCGGCTGAGGTCCGG + Intergenic
1180877912 22:19183668-19183690 CAGCAGCTGGGCCGGAGGGCAGG + Intronic
1184811146 22:46833027-46833049 CTGGAGCTGCCCAGGCGGACAGG - Intronic
1184834190 22:47011288-47011310 CTGCAGCTGTGCCTGTGGTCGGG + Intronic
954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG + Exonic
965474061 3:169132113-169132135 CAGGAGCTGGGCCTGAGGGCAGG - Intronic
967844282 3:194031935-194031957 CTGGCGCTGCACCTGAGGTTGGG - Intergenic
968534378 4:1113894-1113916 CGGGAGCTGGGCCGGAGGCCAGG + Intergenic
968908240 4:3464174-3464196 CTGCAGCTGCTCCAGAGGACAGG + Intronic
969623817 4:8292478-8292500 GTGCAGCTGGGCCGGAGGCCTGG + Intronic
969890493 4:10255513-10255535 CTGGAACTGCTCTGGGGGTCAGG + Intergenic
973696698 4:53497435-53497457 CTGGAGCTGCACCAGAGAACAGG - Intronic
975169039 4:71212417-71212439 CTGGAGCTGGGCAGAAGGTGGGG + Intronic
977206566 4:94170135-94170157 CTGGGGCTGCGCAGGAGCCCAGG - Intergenic
979498429 4:121411339-121411361 CTGCAGCTGCTCTGGAGGTTGGG + Intergenic
981659192 4:147146263-147146285 CTGCAGCTGCGCCTGAGCTCTGG - Intergenic
985666483 5:1183938-1183960 CTGGGGCTGCGCCCGGGGTGGGG - Intergenic
985977071 5:3428508-3428530 CTGCCGCTGCGCCTGGGGTCTGG - Intergenic
990490501 5:56298542-56298564 CTGAAGTTGGGCCAGAGGTCTGG + Intergenic
992796786 5:80260655-80260677 CTGGAGCTGCAACTGAAGTCTGG - Intergenic
992880596 5:81105451-81105473 CTGGAGCTGTGTGGGAGCTCTGG + Intronic
995179658 5:109219171-109219193 CTGGAGCTGAGCCTGGGCTCTGG + Intergenic
996862716 5:128083927-128083949 CTGCAGTTCCGCCGGGGGTCGGG + Exonic
998261740 5:140636921-140636943 CTGGAGCTGCCAAGGGGGTCTGG + Intergenic
999133060 5:149299339-149299361 CGGGAGCTGCGTGGCAGGTCTGG + Intronic
1001005433 5:168045656-168045678 CTGCAGCTGCACTGGAGGTGCGG - Intronic
1001513496 5:172339255-172339277 TTGGAGATGGGCCGGAGGTTGGG + Exonic
1002526145 5:179817080-179817102 CCGGAGCCGCGCCGGGGGCCGGG + Intronic
1003874141 6:10422087-10422109 GCGGAGCTGCGGAGGAGGTCGGG - Intergenic
1004511659 6:16288447-16288469 CTGGCGCTGCGCTGGATTTCTGG + Intronic
1006923752 6:37642879-37642901 CTGGAACTGAGCAGGAGCTCTGG + Intronic
1007398388 6:41590046-41590068 CAGGGGCTGCGGCCGAGGTCGGG - Exonic
1013175118 6:107669934-107669956 CTGGAGCTTAACCGTAGGTCAGG + Intergenic
1013273463 6:108561864-108561886 CTCGCGCTGCGCAGGAGGCCCGG - Intronic
1017324749 6:153131539-153131561 CCGGAGCTTCGCGGGAGGCCCGG + Intergenic
1019314776 7:379394-379416 CTGAAGCTGCCCCGGAGGGGAGG + Intergenic
1019412411 7:912068-912090 CTGGGGCTGTGCACGAGGTCTGG - Intronic
1020118606 7:5490418-5490440 CTGCTGCTGCGCAGGAAGTCAGG - Intronic
1024101163 7:46033980-46034002 CTGGAGCTTCGCAGAAGGTCCGG - Intergenic
1024996689 7:55278027-55278049 CTGGAGCAGCCCTGGAGGTTAGG - Intergenic
1026905043 7:74057958-74057980 CTGGAGCTCAGCATGAGGTCAGG - Intronic
1029178487 7:98682500-98682522 CAGGAGGATCGCCGGAGGTCAGG + Intergenic
1030185121 7:106754195-106754217 CTGGAGCTGCGTCATAGGCCAGG - Intergenic
1030270076 7:107661186-107661208 CTGGAGCTGCGTCCCGGGTCAGG + Intronic
1033049101 7:137988127-137988149 CTTCAGCTGGGCCTGAGGTCGGG - Intronic
1040986175 8:53296551-53296573 CTGGTGCGGCGCCCGAGGCCTGG - Intergenic
1044635408 8:94319324-94319346 CTGGACCTGCGCTGGAGGGAAGG - Intergenic
1045300848 8:100908607-100908629 CTGCAGCTGCGCAGGAGGGTGGG + Intergenic
1049869979 8:144966909-144966931 CTGGCGCTGCGCCCTGGGTCTGG + Intergenic
1052904143 9:33818307-33818329 CTGGAACTGCCCCAGAGGGCAGG + Intronic
1053272983 9:36762812-36762834 CTGGAGCTGGGAGGGAGGCCTGG + Intergenic
1056351414 9:85752777-85752799 CTGGAGCATCACCGGAGGCCAGG + Intergenic
1056720271 9:89065199-89065221 CTGAAGCTGGGCAGGAGGACAGG + Intronic
1057207044 9:93179669-93179691 GAGGAGCTGCGGGGGAGGTCAGG + Intergenic
1057385119 9:94600061-94600083 CTGGAGAGGCGCCGGTTGTCCGG + Intergenic
1058800610 9:108541304-108541326 CTTGAGCTGCTGGGGAGGTCTGG + Intergenic
1060589831 9:124809761-124809783 CTGGGGTTGCTCGGGAGGTCTGG + Intronic
1060809685 9:126604350-126604372 CTGGAGCGGAGGTGGAGGTCAGG + Intergenic
1061102750 9:128504648-128504670 CGGGAGCGTCGCCGGAGGTGGGG + Intergenic
1062707109 9:137951883-137951905 TTGGAGCTGCCCAGGATGTCTGG + Intronic
1185641659 X:1592052-1592074 CTGGAGCGGTGTCGGAGGGCTGG + Intronic
1189323822 X:40101289-40101311 CGGGAGCTGACCCGGGGGTCAGG + Intronic
1191257035 X:58284008-58284030 CAGGAGCCACGCCGGAGGTCAGG - Intergenic
1192434243 X:71132974-71132996 ATGGAGGTGGGCAGGAGGTCAGG + Intronic
1200155289 X:153971842-153971864 CGGCAGCGGCGCCGGCGGTCGGG + Intergenic
1200745808 Y:6903088-6903110 CTGGAGATCCACCTGAGGTCAGG - Intergenic
1201792500 Y:17857673-17857695 CTGGAGCTCTGCCTGAGGTCAGG + Intergenic
1201809054 Y:18048313-18048335 CTGGAGCTCTGCCTGAGGTCAGG - Intergenic
1202338668 Y:23836866-23836888 CTGGAACTCCACCTGAGGTCAGG + Intergenic
1202354037 Y:24026918-24026940 CTGGAGCTCTGCCTGAGGTCAGG + Intergenic
1202516742 Y:25643194-25643216 CTGGAGCTCTGCCTGAGGTCAGG - Intergenic
1202532098 Y:25833206-25833228 CTGGAACTCCACCTGAGGTCAGG - Intergenic