ID: 954200939

View in Genome Browser
Species Human (GRCh38)
Location 3:49022710-49022732
Sequence TGTCTTCGGTGATGTCCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954200939_954200947 14 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200947 3:49022747-49022769 TGGTTGCTGGAGCCCCGGATAGG 0: 1
1: 0
2: 3
3: 10
4: 156
954200939_954200943 1 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200943 3:49022734-49022756 CTTTTCCCTCTTCTGGTTGCTGG 0: 1
1: 0
2: 2
3: 30
4: 329
954200939_954200956 28 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200956 3:49022761-49022783 CCGGATAGGTACTGGGGAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 124
954200939_954200942 -6 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200942 3:49022727-49022749 AAGACAGCTTTTCCCTCTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 242
954200939_954200954 27 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200954 3:49022760-49022782 CCCGGATAGGTACTGGGGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 97
954200939_954200948 20 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200948 3:49022753-49022775 CTGGAGCCCCGGATAGGTACTGG 0: 1
1: 0
2: 1
3: 5
4: 87
954200939_954200949 21 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200949 3:49022754-49022776 TGGAGCCCCGGATAGGTACTGGG 0: 1
1: 0
2: 1
3: 3
4: 54
954200939_954200950 22 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200950 3:49022755-49022777 GGAGCCCCGGATAGGTACTGGGG 0: 1
1: 0
2: 0
3: 7
4: 75
954200939_954200946 9 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200946 3:49022742-49022764 TCTTCTGGTTGCTGGAGCCCCGG 0: 1
1: 0
2: 3
3: 23
4: 296
954200939_954200952 26 Left 954200939 3:49022710-49022732 CCACCAGGACATCACCGAAGACA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 954200952 3:49022759-49022781 CCCCGGATAGGTACTGGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954200939 Original CRISPR TGTCTTCGGTGATGTCCTGG TGG (reversed) Exonic
901243172 1:7706843-7706865 TGGCTTTGGTGATACCCTGGCGG + Intronic
904943036 1:34177948-34177970 TGTCTTGGGGTGTGTCCTGGTGG - Exonic
906151277 1:43589036-43589058 TGTCATCTGGGAGGTCCTGGTGG + Intronic
907615522 1:55920874-55920896 TGTGTTCTGTCATGTCCTGGAGG + Intergenic
907810372 1:57863787-57863809 TTTCTTTGGTGATGCCCTAGAGG - Intronic
912488651 1:110048972-110048994 TGACTTCTGAGATGTCCTTGGGG + Intronic
914295199 1:146315319-146315341 TGTCTTCTTTGATGCCCTTGGGG + Intergenic
914556240 1:148766102-148766124 TGTCTTCTTTGATGCCCTTGGGG + Intergenic
914616596 1:149364131-149364153 TGTCTTCTTTGATGCCCTTGGGG - Intergenic
920512938 1:206564280-206564302 TGTCTTGGGTGAGTTCCAGGTGG - Intronic
922703480 1:227775995-227776017 TGGCTTTGGTGCTATCCTGGGGG + Intronic
922756472 1:228099785-228099807 TGTCTTGGGTGCTGTCAAGGGGG - Intergenic
1069724937 10:70571485-70571507 TGTCTTCCCTGCTGCCCTGGTGG + Intergenic
1072384871 10:94914458-94914480 TATCTTCTTTGATGTCCTTGGGG + Intergenic
1072616269 10:97050585-97050607 TGTGTTTGCTGATATCCTGGGGG + Intronic
1072652845 10:97309172-97309194 TGTCATCTGTGATGTCATGAGGG + Intergenic
1075723950 10:124602375-124602397 TGGTATCGCTGATGTCCTGGAGG + Intronic
1077631122 11:3811591-3811613 TGCCTTCTGTGAGGTTCTGGAGG + Intronic
1080634311 11:34110076-34110098 TTTCTTAGGTGATGCCATGGTGG - Intronic
1080683190 11:34495013-34495035 CCTCTTCTGTGATCTCCTGGGGG - Intronic
1081048236 11:38303797-38303819 TGTCTCCTGTGATGTCGTGTAGG + Intergenic
1083588710 11:63879447-63879469 TGTCTTCTGTGATTGCCTTGAGG + Intronic
1094770694 12:33655087-33655109 TGTCTTTGGTTATGTCATCGGGG + Intergenic
1100569414 12:95832989-95833011 TGTTATCGGTGATGTCCTCAGGG - Intergenic
1101332559 12:103768929-103768951 GGTCTTCGATGATGTCTTCGAGG - Intergenic
1102607296 12:114077766-114077788 TGTCTTCTGTCCTGTCCTGTGGG - Intergenic
1103446674 12:120999476-120999498 TGTCTGAGGTGAAGACCTGGGGG - Exonic
1104156222 12:126135795-126135817 TTTCTTCTTTGATGTCCTTGGGG + Intergenic
1105727450 13:23178357-23178379 TGTCTTCTGTGACATTCTGGGGG + Intergenic
1109105118 13:58240329-58240351 TATCTTCTTTGATGTCCTTGGGG - Intergenic
1109426720 13:62174097-62174119 TGCCTTCCTGGATGTCCTGGAGG + Intergenic
1114630306 14:24155270-24155292 TGTCATCGGTGAGGTCGGGGCGG - Exonic
1115351459 14:32400018-32400040 TGTCATTGCTGAGGTCCTGGTGG - Intronic
1121484768 14:94306151-94306173 TGACCTCGGAGATGTGCTGGAGG - Exonic
1122836565 14:104433638-104433660 CTTCCTCGGTGATGTCCTGTGGG + Intergenic
1126892774 15:53223773-53223795 TTTCTTCACTGCTGTCCTGGGGG + Intergenic
1129874961 15:78968724-78968746 TGCTTTCAGTGATGTCCAGGTGG + Intronic
1131092226 15:89631695-89631717 TGTCCTCGTTGAGGGCCTGGGGG + Exonic
1136280294 16:29204645-29204667 TGTCATCTGTGATGACGTGGAGG - Intergenic
1138661005 16:58516756-58516778 TGTCTTGGGTGAGGGACTGGGGG - Intronic
1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG + Intergenic
1142084654 16:88170587-88170609 TGTCATCTGTGATGACGTGGAGG - Intergenic
1142470006 17:158011-158033 TGTCTTCGGGGTTCTCCTGAGGG - Intronic
1143892349 17:10112222-10112244 TGTCTTCGGTCACGTGCTCGAGG - Intronic
1145304412 17:21665404-21665426 GGCCTTTGGTGAGGTCCTGGTGG + Intergenic
1150901665 17:69284882-69284904 TGTCTTCTGGGATCTCCTGTAGG - Intronic
1152181814 17:78827024-78827046 TGTCTCCGGAGACGTCCTGCTGG - Intronic
1153763245 18:8351794-8351816 TTTCTTGGCTGATGTGCTGGGGG - Intronic
1157125165 18:44949931-44949953 TGTCACCGGTGAAGTCCTGTGGG - Exonic
1157186999 18:45549232-45549254 TGCCTTCGGTGGATTCCTGGAGG + Intronic
1157359217 18:46963196-46963218 TTTCTTCCTTGAAGTCCTGGAGG + Exonic
1157360211 18:46969123-46969145 TTTCTTCCTTGAAGTCCTGGAGG + Exonic
1157360812 18:47022715-47022737 TTTCTTCCTTGAAGTCCTGGAGG + Exonic
1157361801 18:47028630-47028652 TTTCTTCCTTGAAGTCCTGGAGG + Exonic
1160243310 18:77137855-77137877 TGTCTTTCGAGGTGTCCTGGGGG + Intergenic
1160286910 18:77551364-77551386 TGGCTTCTGTGATGTCCAAGTGG - Intergenic
1161200974 19:3014599-3014621 TGTCTTCGTCGCTTTCCTGGGGG + Exonic
1162433136 19:10641428-10641450 TGTCGTAGGTGGTTTCCTGGAGG + Intronic
929711464 2:44271054-44271076 TGTCATCTATGATGTCCTGAGGG - Intergenic
932456950 2:71856016-71856038 TGTCTTTGCTGCTGTCCTGCAGG + Intergenic
933481016 2:82857319-82857341 TGTTTTCTTTGATGTCCAGGAGG + Intergenic
934992870 2:98933707-98933729 GGTTTTCTGTGATGTCCTGGTGG - Intronic
943164524 2:184302913-184302935 TGAATTCTGTGATGTCCTGGAGG - Intergenic
945513778 2:210735906-210735928 TGTGTTGAGTCATGTCCTGGTGG + Intergenic
1170318831 20:15071379-15071401 TCTCATCTGTGATTTCCTGGAGG + Intronic
1171355726 20:24544243-24544265 TCTCACCGGTGCTGTCCTGGGGG - Intronic
1172968754 20:38858280-38858302 TGTCTTCTCTGATGTCCCTGGGG + Intronic
1173236187 20:41247787-41247809 TGTCTTCAGTGATTCCCTGCAGG + Intronic
1176151355 20:63592735-63592757 TGGCTATGGTGATGTCCTTGTGG - Intronic
1176268220 20:64221715-64221737 TGTCTTCTGTGTTTTGCTGGGGG + Intronic
1176655737 21:9587831-9587853 GGCCTTTGGTGAGGTCCTGGTGG + Intergenic
1177321095 21:19521976-19521998 TGTCTTCCTTGTTGGCCTGGAGG - Intergenic
1178632076 21:34270519-34270541 TGTATTCGGTGATGTCATGTTGG + Intergenic
1180855665 22:19043272-19043294 TGTGTTGGGGGCTGTCCTGGAGG - Intronic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1184288040 22:43483069-43483091 TGTCTTGTGTGAGGTCCTGTGGG + Intronic
953667793 3:44938425-44938447 TGTCATCTGTGATGTCATGAGGG - Intronic
953817280 3:46169842-46169864 TTTCTTCTTTGATGCCCTGGGGG + Intronic
954200939 3:49022710-49022732 TGTCTTCGGTGATGTCCTGGTGG - Exonic
954220112 3:49148276-49148298 TGCATTCAGTGATGTCCTAGGGG - Intergenic
954689663 3:52388880-52388902 CATCTCCGGCGATGTCCTGGTGG + Exonic
954844289 3:53541855-53541877 TGACTTAAATGATGTCCTGGAGG - Intronic
955784057 3:62517585-62517607 TGTTTTTAGTGCTGTCCTGGTGG - Intronic
956705077 3:71992712-71992734 TGTGTTCAGTGATGTCATGATGG + Intergenic
957716757 3:83938101-83938123 TTTATTTGGTGATGACCTGGAGG - Intergenic
958083416 3:88775335-88775357 GGTCTTCGGTAAGGTCCAGGAGG - Intergenic
958608262 3:96388766-96388788 TGTCATCTGTGATTTCCTTGAGG + Intergenic
959498846 3:107081867-107081889 TGTCTTGGCTGTTGTCCTAGAGG - Intergenic
961039485 3:123667138-123667160 TGCCTTCGGAGGTGTCTTGGGGG + Exonic
961364339 3:126389847-126389869 TGTCTCCTCTGCTGTCCTGGAGG - Intergenic
967659648 3:192091011-192091033 TGTCTTCTTTGATGCCCTTGGGG - Intergenic
968531033 4:1091762-1091784 TGTCATCCCTGCTGTCCTGGAGG - Intronic
968605728 4:1534421-1534443 TGTCTTGGGCTATGTCCTCGTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
972559200 4:40211594-40211616 CGTCATAGGTGATGTCTTGGGGG + Intronic
972864365 4:43212210-43212232 TGTCTTTGGTGATATGGTGGGGG + Intergenic
975834480 4:78407763-78407785 TGCCTTCATTGATGTCCTGCTGG - Exonic
978463336 4:108982259-108982281 TGCCTTGGGAAATGTCCTGGGGG + Intronic
982879014 4:160686718-160686740 TATCTTCTTTGATGTCCTTGGGG - Intergenic
989108060 5:37881857-37881879 TGTGTTCTTTGATGCCCTGGGGG + Intergenic
991027940 5:62051529-62051551 TATCTTCTTTGATGTCCTTGGGG + Intergenic
1000534903 5:162468288-162468310 TTTCTTGGGTCAGGTCCTGGGGG - Intergenic
1001094331 5:168764592-168764614 TGCCTTCTGTGATTTCCTTGTGG + Intronic
1002228291 5:177741502-177741524 TGTCTTCCGTGGTTTCCTGATGG - Intronic
1003126966 6:3363365-3363387 TGTCTTAGGTCCTGTTCTGGCGG - Intronic
1004875789 6:19952369-19952391 AGTCTTTGGTGATGTCTTTGGGG + Intergenic
1005139542 6:22612333-22612355 TTTCTTCGGTTATGTATTGGAGG + Intergenic
1013426447 6:110017253-110017275 GGACTTCTGTGATCTCCTGGGGG + Intergenic
1013627710 6:111954105-111954127 TGTGTTCAGTGATGTCATGTTGG + Intergenic
1014062280 6:117085475-117085497 TGTCATCAGAGATGACCTGGTGG + Intergenic
1014510112 6:122310123-122310145 TGTTTTTGTTCATGTCCTGGTGG - Intergenic
1017829453 6:158112720-158112742 TGGCTTAGGTGCTGTTCTGGTGG - Intronic
1023069939 7:36419311-36419333 CCTCTTCAGTGATGTCCTAGAGG + Exonic
1023258395 7:38334819-38334841 TGTCTTCAGGAAAGTCCTGGGGG + Intergenic
1023260460 7:38353494-38353516 GGTCTTCAGGGAAGTCCTGGGGG + Intergenic
1025282429 7:57638018-57638040 GGCCTTTGGTGAGGTCCTGGTGG + Intergenic
1025302301 7:57827501-57827523 GGCCTTTGGTGAGGTCCTGGTGG - Intergenic
1027673864 7:81135120-81135142 TGTGTTCGTTGATGTCATGTTGG + Intergenic
1034201069 7:149283294-149283316 TGTCTTGGCTGCTGTCTTGGAGG + Exonic
1034737441 7:153441924-153441946 TGTGTTTGTTGATGTACTGGTGG + Intergenic
1035616695 8:1007271-1007293 TGACTGCTGTGATTTCCTGGAGG + Intergenic
1040764059 8:50885207-50885229 TGACTTCAGTTATGTCCTGCAGG + Intergenic
1041108337 8:54462640-54462662 CGTATTTGGTGATGTCATGGGGG - Intergenic
1043738460 8:83776057-83776079 TATCCTCTTTGATGTCCTGGGGG - Intergenic
1044482963 8:92714192-92714214 TGTCTCTGGTGCTGTCCTGGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046745242 8:117868983-117869005 TGGCTCCGGGGAGGTCCTGGGGG - Intronic
1048478483 8:134765360-134765382 TGTGTTCAGGGATGTCCTGTTGG + Intergenic
1049291536 8:141805540-141805562 TGTCTTTGGAGGTGTCCCGGGGG + Intergenic
1049567071 8:143346186-143346208 TGCCTTCGGAGCTGTTCTGGAGG - Intronic
1053900078 9:42787093-42787115 TTTCTTCAGATATGTCCTGGTGG + Intergenic
1056546485 9:87617963-87617985 AGTCTTCCGTGATGTCCTGCAGG + Intronic
1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG + Intergenic
1061521183 9:131119039-131119061 TGTCTTCCGTGATGTCCTGAGGG + Intronic
1062431135 9:136527368-136527390 TGTCTTCAATGCTGTCCCGGCGG + Intronic
1203633454 Un_KI270750v1:91292-91314 GGCCTTTGGTGAGGTCCTGGTGG + Intergenic
1185505687 X:631062-631084 CGCCCTCCGTGATGTCCTGGAGG - Exonic
1189926530 X:45960472-45960494 TATCTTCTTTGATGTCCTTGGGG - Intergenic
1192635047 X:72808143-72808165 TGTCTTCATTGAAGTCCTGTTGG - Intronic
1192646668 X:72912660-72912682 TGTCTTCATTGAAGTCCTGTTGG + Intronic
1194774496 X:97945168-97945190 TATCTTCTTTGATGTCCTGAGGG - Intergenic
1194838142 X:98707917-98707939 TGTCTTTTGTGATTTACTGGAGG + Intergenic
1197551550 X:127898325-127898347 TATCTTCTTTGATGTCCTTGAGG - Intergenic
1198838800 X:140834040-140834062 TGTGTTTGGTGATGTGATGGTGG + Intergenic
1199735405 X:150681456-150681478 TGTATTCAGTGATGTCAAGGTGG + Intergenic