ID: 954201313

View in Genome Browser
Species Human (GRCh38)
Location 3:49025002-49025024
Sequence GGGCCTCAGTGGTGGCAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 5, 2: 6, 3: 41, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954201305_954201313 3 Left 954201305 3:49024976-49024998 CCCATCGGAAAAGAAGTATTCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG 0: 1
1: 5
2: 6
3: 41
4: 350
954201302_954201313 26 Left 954201302 3:49024953-49024975 CCGCGATATTTCTTTAGCCGGAT 0: 1
1: 0
2: 0
3: 4
4: 27
Right 954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG 0: 1
1: 5
2: 6
3: 41
4: 350
954201304_954201313 9 Left 954201304 3:49024970-49024992 CCGGATCCCATCGGAAAAGAAGT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG 0: 1
1: 5
2: 6
3: 41
4: 350
954201306_954201313 2 Left 954201306 3:49024977-49024999 CCATCGGAAAAGAAGTATTCACC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG 0: 1
1: 5
2: 6
3: 41
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954201313 Original CRISPR GGGCCTCAGTGGTGGCAGCC AGG Exonic
900109402 1:999223-999245 GGGCCTCTGCGGGGGCAGCCGGG + Exonic
900192459 1:1357195-1357217 GGGCCTGTGGGGCGGCAGCCGGG - Intronic
900539570 1:3196104-3196126 GGAGCTCACTGGGGGCAGCCAGG + Intronic
900573918 1:3373694-3373716 GGGCATCAGTTCTAGCAGCCTGG + Intronic
900972027 1:5997065-5997087 GTGCCTCAATGGTAGGAGCCTGG + Intronic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901632304 1:10653785-10653807 TGGCGGCAGTGGCGGCAGCCAGG + Exonic
901636949 1:10674914-10674936 GGCCCTCTGTCGTGGCAGCAGGG + Intronic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
901811918 1:11772211-11772233 GGGGCTCAGTGGGGCCACCCAGG - Exonic
901884938 1:12216178-12216200 GGGCCACAGTGGTGGTGGCAGGG - Intergenic
902563650 1:17295537-17295559 GCGGCTCAGTGATGGCATCCTGG - Intergenic
902771709 1:18648974-18648996 GGGCATCAGTGGCGGGAGTCTGG - Intronic
904472593 1:30745382-30745404 GTGCCTCAGTGGAGGCAGAGAGG + Intronic
904493340 1:30873435-30873457 GGTCCTCAGGGGTGGGGGCCAGG + Intronic
904624431 1:31794083-31794105 GGGGTGCAGGGGTGGCAGCCAGG - Intronic
907518035 1:55005837-55005859 GGGAGTCAGTGATGGAAGCCGGG + Intronic
907554718 1:55334151-55334173 GGGCCTCAATGGGGCCACCCTGG + Intergenic
908127182 1:61043421-61043443 GGGCCTCTGTGGCTGGAGCCCGG - Intronic
909631396 1:77773030-77773052 GGGAGTGAGTGGAGGCAGCCAGG - Intergenic
909918281 1:81348056-81348078 TGGCCTCTGTGGTGGCTACCTGG - Intronic
912129477 1:106584049-106584071 GTGCCTCACTGGTGGCTTCCAGG - Intergenic
914381556 1:147121044-147121066 GGGCCCCATTGGGGGCAGGCAGG - Intergenic
915168500 1:153962240-153962262 GGGCCTCATCTATGGCAGCCAGG + Exonic
915264651 1:154708086-154708108 GGGCCTCGATGATGGCAGACAGG + Exonic
915525025 1:156470650-156470672 TGGCCTAAGTGGAGGTAGCCTGG - Intronic
916173351 1:162018610-162018632 GGGCCTCTGTACTGGCAGGCAGG - Intronic
916826928 1:168451223-168451245 TGGCCCCTGTGGTGGCAGGCTGG - Intergenic
918185851 1:182127212-182127234 AGGCCACAGTGGAGCCAGCCTGG + Intergenic
919752075 1:201044002-201044024 TGGCCTCAGTGGAGGCAGGCAGG + Intronic
920067211 1:203277402-203277424 GGGCCTGGGTGGGGGCAGCCAGG - Intergenic
920108133 1:203568930-203568952 GAGCCTCTGAGGAGGCAGCCTGG - Intergenic
920426331 1:205879552-205879574 GGGCCCCAGTTTTGGCAGCAGGG + Intergenic
920842253 1:209564735-209564757 GGTCCTGAGTGGAGGCAGGCTGG + Intergenic
922261710 1:223949954-223949976 GGGCAGCAGTGGTGCCAGTCGGG + Intergenic
922472994 1:225888095-225888117 GGGCCACTGAGCTGGCAGCCAGG + Intronic
922480996 1:225940065-225940087 GGGCCACTGAGCTGGCAGCCAGG + Intronic
922499118 1:226083722-226083744 GGACCTCACTGCAGGCAGCCCGG - Intergenic
922564014 1:226589483-226589505 AGACCACAGTGATGGCAGCCAGG + Intronic
922763688 1:228147073-228147095 GGGCCACAGACGTGGGAGCCTGG - Intronic
923339903 1:232998326-232998348 TGCCCCGAGTGGTGGCAGCCAGG - Exonic
924520861 1:244805023-244805045 GGGCCACAGTGCTGGGCGCCGGG - Intergenic
1062853102 10:760218-760240 AGGCCCCAGTGGTGGCAGTGGGG - Intergenic
1064002430 10:11674648-11674670 TGGACTCATGGGTGGCAGCCTGG + Intergenic
1065589769 10:27252529-27252551 GGGCCTCGGTGGTGCACGCCAGG + Intergenic
1065596643 10:27319793-27319815 GGTCCCCAGTGCTGGCAGCCTGG - Intergenic
1066464783 10:35641936-35641958 GGGGCCGAGTGGTGGCCGCCAGG - Exonic
1067481506 10:46602494-46602516 GGACCACAGTGGTAGCTGCCTGG + Intergenic
1067613246 10:47739235-47739257 GGACCACAGTGGTAGCTGCCTGG - Intergenic
1067944965 10:50683550-50683572 GGGCCTGGGTGGTGTCAGGCAGG - Intergenic
1067944994 10:50683637-50683659 GGGCCTGGGTGGTGGCAGGCGGG - Intergenic
1069286284 10:66719823-66719845 TGGCCTCAATGGTAGCAGCTAGG + Intronic
1069628546 10:69882973-69882995 GGGCACCCTTGGTGGCAGCCAGG + Intronic
1070057960 10:72953690-72953712 GGGGCTCTGTGCCGGCAGCCAGG + Intronic
1070064688 10:73021908-73021930 GGACCTGAGAGGTTGCAGCCTGG + Intronic
1070777760 10:79119793-79119815 GTGCCTCTGAGGTGGCAGCCAGG + Intronic
1070866466 10:79710421-79710443 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1070866497 10:79710508-79710530 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1070880257 10:79848552-79848574 GGGTCTGGGTGGTGGCAGGCAGG - Exonic
1070880287 10:79848639-79848661 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071124972 10:82323337-82323359 GGACCTCAATAGTGTCAGCCAGG + Intronic
1071484232 10:86087794-86087816 GGGTCTCAGTGGTTGCGGGCTGG - Intronic
1071628657 10:87199340-87199362 GGACCACAGTGGTAGCTGCCTGG - Intergenic
1071633376 10:87232642-87232664 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071633407 10:87232729-87232751 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071646825 10:87364860-87364882 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071646856 10:87364947-87364969 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1072443758 10:95480111-95480133 GGGAGGCAGTGATGGCAGCCAGG + Intronic
1072951249 10:99848460-99848482 GGGCCTCAGTGGTGGTAGGCAGG + Intronic
1073083314 10:100873319-100873341 GGGCTTCAGGGATGGCAGCCAGG + Intergenic
1073452364 10:103617468-103617490 AGGCCCCAGAGGTGGCAGCAGGG + Intronic
1075655835 10:124160543-124160565 GTGCCTCAGAGGAGACAGCCTGG - Intergenic
1076579415 10:131496668-131496690 TGGCCTCAGAGATGCCAGCCAGG - Intergenic
1076669614 10:132112268-132112290 GGGCCTCAGGTGTGGGAGCGGGG + Intronic
1076880455 10:133237070-133237092 TGGCCACAGTGGGGACAGCCTGG + Intergenic
1076924503 10:133475667-133475689 GGGCCTCAGACTGGGCAGCCAGG + Intergenic
1076939179 10:133590415-133590437 GGGCCTCAGTGGTTGCCTCTGGG + Intergenic
1076996148 11:298434-298456 GGGCCCCAGGGGCAGCAGCCTGG + Exonic
1077283583 11:1756274-1756296 GGGGCACAGGGGAGGCAGCCAGG - Intronic
1077478842 11:2803562-2803584 GGGCTTCAGTGGAGCCCGCCAGG + Intronic
1078175173 11:8964581-8964603 GGGCCTCTGGGGTGGCAGCCTGG + Exonic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1081706139 11:45182814-45182836 GGGCCTCAGTTGTTGCAGGGAGG - Intronic
1082793738 11:57365297-57365319 GGGCCTCTGTGCTGGCAGTGAGG + Intronic
1083471890 11:62889526-62889548 GGGACTGAGGGGTGGGAGCCTGG + Intergenic
1083644524 11:64164883-64164905 GGGGCTCAGTAGCGGCAGCTTGG + Intronic
1083905023 11:65663502-65663524 GGGCCTCAGTCGTCCCATCCGGG - Intergenic
1084506230 11:69570125-69570147 GGCCCCCAGTGGAGGCAGGCTGG + Intergenic
1084860083 11:72012508-72012530 GAGCCTCAGTGAGGTCAGCCTGG - Intronic
1085037959 11:73310864-73310886 GCTCTTCAGAGGTGGCAGCCCGG - Exonic
1085047497 11:73362226-73362248 AGGCCTCACCGGTGGCAGCGAGG - Exonic
1085328072 11:75623916-75623938 GGGTCTCAGTGTGGGCAGCCGGG - Intronic
1085408362 11:76277380-76277402 GGGCTGCAGTGGAGGCAGCCAGG - Intergenic
1088990149 11:114946705-114946727 AGAACTCAGTGGTGGTAGCCTGG - Intergenic
1089702701 11:120255085-120255107 GGCCCCCAGAGGTGGCAGGCAGG - Intronic
1089937388 11:122378086-122378108 GGGCCCCTGTGGTGCCAGGCAGG - Intergenic
1097183672 12:57185033-57185055 GGGCATCAGTGGAGGCAGGAGGG - Intronic
1097190202 12:57216155-57216177 GGGGGTCAGTGGTGGGGGCCAGG + Intergenic
1097987936 12:65803992-65804014 GGTGCTAAGTGATGGCAGCCAGG + Intergenic
1098299179 12:69036689-69036711 GGGACTCCGAGGTGACAGCCTGG + Intergenic
1101967597 12:109291920-109291942 CGGCCGGAGGGGTGGCAGCCGGG - Intronic
1103567281 12:121823072-121823094 GGGCAGCAGGGGTGGCAGCGGGG - Exonic
1103703993 12:122861665-122861687 GGGGGTCAGTGGTCACAGCCAGG - Intronic
1103927035 12:124429004-124429026 GGGCCCCAGTGACGGCAGCCAGG + Intronic
1103937520 12:124484448-124484470 GAGCCTCAGAGGTGGAGGCCAGG - Intronic
1104035174 12:125092763-125092785 GGCCCTCTGTGGGGGCTGCCTGG + Intronic
1104308399 12:127631551-127631573 CGGCCTCAGTGGTTGCATGCAGG + Intergenic
1105241218 13:18610693-18610715 GGGCCTCAGTGGTGGCTGCCAGG - Intergenic
1107548939 13:41457649-41457671 GGTCCTGCGAGGTGGCAGCCGGG - Exonic
1108729547 13:53220172-53220194 GGCACTGGGTGGTGGCAGCCTGG + Intergenic
1109502901 13:63260668-63260690 GGGCCTGAGTGTTAGGAGCCTGG - Intergenic
1110363626 13:74657140-74657162 GGGACTCAGTGGTCACAGCACGG - Intergenic
1113890958 13:113735421-113735443 CTGCCTCCGTGGTGCCAGCCTGG + Exonic
1117051464 14:51864669-51864691 GTGCCTCCGTAGTGGTAGCCTGG - Intronic
1119874211 14:78043260-78043282 GGGACTCAGTGGAGACACCCAGG - Intergenic
1120254871 14:82105931-82105953 GGGCCACAGTGGGGGCAGGTGGG - Intergenic
1120857850 14:89228049-89228071 GTTACTCACTGGTGGCAGCCTGG + Intronic
1121467191 14:94123514-94123536 GGGCCTCATGGGTGGGACCCTGG + Intergenic
1121584299 14:95052319-95052341 GGGCCTGGGGGGTGGCAGGCAGG - Intergenic
1121897703 14:97663970-97663992 GGGCCTCAGAGAAGGCTGCCTGG + Intergenic
1122100634 14:99406883-99406905 GGGCCTCCCTGGTGGCAGTGAGG + Intronic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1123490138 15:20774454-20774476 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1123546639 15:21343541-21343563 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1124453620 15:29821787-29821809 GGGCCGCACTGGGGGCGGCCGGG - Intronic
1125005365 15:34810971-34810993 GGGCCTGAATGCTGGCAGCCAGG + Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1126813560 15:52432800-52432822 GAGACTCATTGGTGGCAGCATGG - Intronic
1127817642 15:62625762-62625784 GGGCTTCTGTGTTGCCAGCCTGG + Intronic
1127850865 15:62910600-62910622 CAGCCACAGTGGTGCCAGCCTGG - Intergenic
1128327432 15:66734113-66734135 GGCCATCAGTGCTTGCAGCCAGG + Intronic
1128469954 15:67943746-67943768 GGGACCCAGTGGTGGCCTCCTGG - Intergenic
1129466720 15:75728263-75728285 GGGCCACATTGTGGGCAGCCGGG + Intergenic
1129795811 15:78375084-78375106 GGGGATCAGTGGTGGCAGCCGGG + Intergenic
1130298999 15:82666161-82666183 GGGCCCCAGGAGTGGAAGCCAGG - Intronic
1130362141 15:83199540-83199562 GGGAGTCAGTGGTAGCTGCCAGG - Intronic
1131269093 15:90935612-90935634 GGGCCTGAGTGTAGGCCGCCAGG - Exonic
1131459630 15:92609179-92609201 GGGCCCCAGTGGGAGGAGCCAGG - Intergenic
1132025814 15:98403661-98403683 GGGCCGCAGTGGTGGGAAGCAGG + Intergenic
1132355824 15:101170559-101170581 GGGCCTCCGTTTGGGCAGCCAGG - Intergenic
1202954969 15_KI270727v1_random:70756-70778 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1132628120 16:902016-902038 GGGCCCCAGTGCTGGTGGCCAGG - Intronic
1133063105 16:3188247-3188269 GGGCCTCAGTGGAGACCTCCCGG + Intergenic
1133298450 16:4767088-4767110 GGGCCTCAGGCTTGGCAGCCAGG + Exonic
1136374229 16:29855716-29855738 GGCCCCGAGAGGTGGCAGCCTGG - Intergenic
1136746286 16:32594843-32594865 GGTCTTCACTGGTGTCAGCCAGG + Intergenic
1137507310 16:49065433-49065455 GGGCCTGAATGAGGGCAGCCTGG + Intergenic
1138106015 16:54287403-54287425 GGGGCTGAAGGGTGGCAGCCCGG + Intergenic
1139515287 16:67449133-67449155 GGGCCTCAGTGCCACCAGCCTGG - Intronic
1139932748 16:70542454-70542476 GGTGCTCAGTTGTGACAGCCAGG + Intronic
1139961681 16:70721606-70721628 GGACCTCAGACCTGGCAGCCAGG - Intronic
1140855775 16:78976449-78976471 GGCACGCAATGGTGGCAGCCTGG + Intronic
1141402731 16:83764659-83764681 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141402745 16:83764729-83764751 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141554539 16:84828195-84828217 GGGCTCCAGGGCTGGCAGCCCGG - Intronic
1142116231 16:88357491-88357513 GGGCCTCGGTGGCATCAGCCAGG + Intergenic
1142406385 16:89892519-89892541 GGGCCTGAGTGCTGGAGGCCTGG + Intronic
1203048415 16_KI270728v1_random:854047-854069 GGTCTTCACTGGTGTCAGCCAGG + Intergenic
1142806420 17:2373332-2373354 TGGACGCAGTGGTGGCAGCAAGG + Exonic
1142853289 17:2715654-2715676 GGGCAGCATTGCTGGCAGCCTGG + Intergenic
1143153958 17:4823881-4823903 GGGCCTCAGTGGTCCCCGCTGGG + Intergenic
1144485314 17:15659727-15659749 GGGCCTCAGGGGAGCCGGCCTGG - Intronic
1144755984 17:17681214-17681236 GGGCCTCTGCGGTGGGATCCCGG - Intergenic
1144945221 17:18966286-18966308 CGGCCCCATGGGTGGCAGCCTGG + Intronic
1145978869 17:28999710-28999732 GGGCCTCAGTGGAGGCTGAAGGG + Intronic
1146887663 17:36483308-36483330 GGGCCTCCTTGGCGTCAGCCTGG - Intergenic
1147304238 17:39552252-39552274 GGGCCCCAGGGGTGTCAGCAGGG + Intronic
1147490359 17:40860249-40860271 GGGCCTCACTGCTGCCAGCTAGG + Intergenic
1147632735 17:41942627-41942649 GGGCCTCAGGGAAGGCAGCAGGG + Intronic
1150295128 17:64003333-64003355 GGACCTCAGTGGGGGCAGTCAGG + Intronic
1151731174 17:75912204-75912226 GTGCCTCAGCAGTGCCAGCCTGG + Exonic
1151853518 17:76706097-76706119 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151853529 17:76706160-76706182 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853537 17:76706202-76706224 GGGCCTTTGTGATGGCAGCGTGG - Intronic
1151853545 17:76706244-76706266 GGGCCTCTGTGATGGCAGAGTGG - Intronic
1151853549 17:76706265-76706287 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853553 17:76706286-76706308 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853564 17:76706349-76706371 GGGCCTCTGTGATGGCAGAGTGG - Intronic
1151853568 17:76706370-76706392 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853572 17:76706391-76706413 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1152423734 17:80207970-80207992 AGGCCCCAGTGGTGGGAGGCAGG - Intronic
1152965632 18:111835-111857 GGCGCTCCGTGCTGGCAGCCGGG + Intergenic
1153519710 18:5940175-5940197 TGGTCTCAGTGGAGGCATCCAGG + Intergenic
1154199111 18:12287317-12287339 CGGCGTCGGTGCTGGCAGCCAGG + Intergenic
1154214845 18:12408250-12408272 GGGCCTCTGTGCCTGCAGCCAGG - Intronic
1154447739 18:14449208-14449230 GGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1156432673 18:37092493-37092515 GGGCATCAGTCGTGGCAGGTGGG - Intronic
1156491982 18:37501700-37501722 GGGCCTCAGTGGAGGTAGGTAGG + Intronic
1157388652 18:47282191-47282213 GGGGCTCAGTGGTGCCATCCAGG + Intergenic
1157727841 18:49978519-49978541 AGGCCTCAGGGGTGGCACACAGG - Intronic
1158392007 18:57051652-57051674 GGGCCAGGGTGGTGGCAGCAGGG + Intergenic
1158724543 18:59958165-59958187 GGGCCTCAGAGCTGGGAGCCTGG - Intergenic
1160297890 18:77654621-77654643 GGGCCGAACTGGTGGCAACCAGG - Intergenic
1161011523 19:1961520-1961542 GGGCCTCAGTGGGGGATCCCAGG + Intronic
1161083277 19:2321979-2322001 GGGTCTCAGCCGTGGGAGCCGGG - Intronic
1161176078 19:2842617-2842639 GGGCGTCCGTCGTGGTAGCCTGG + Intronic
1161397961 19:4054629-4054651 CGGCCTCCTTGGTGGCATCCAGG + Exonic
1161519670 19:4716798-4716820 GGGGTTCAGTGGAGGCAGCCCGG + Intronic
1161607568 19:5223208-5223230 GGTCCTCCGCGGTGCCAGCCGGG + Exonic
1162034332 19:7931300-7931322 GCGCCCCACAGGTGGCAGCCGGG - Intronic
1162953054 19:14083268-14083290 GGGCCTCTGGGGTGGCTTCCAGG + Exonic
1163607827 19:18284968-18284990 GGGCCTCAGCCTTGGCAGCTGGG + Intergenic
1165058662 19:33194518-33194540 GGGGCTCAGCGGCGGCCGCCAGG - Intronic
1165371367 19:35408453-35408475 GGGCCACGGAGGTGGCAGCACGG + Intergenic
1166083316 19:40458490-40458512 GGGCCCCTCTGATGGCAGCCTGG + Exonic
1166312460 19:41970359-41970381 GGGCCCCAAGGGTGGCTGCCAGG + Intronic
1166859401 19:45801146-45801168 GAGCCTCAGTGGCTGCACCCAGG + Intronic
1167560019 19:50221358-50221380 GGACCTCAGACTTGGCAGCCTGG - Intronic
1168630594 19:57953262-57953284 GGGCCTCAGCCTGGGCAGCCAGG + Intergenic
925044683 2:763887-763909 TGGCCCCAGTGGTGACAGCACGG + Intergenic
925182308 2:1825175-1825197 AGGCCTCAGGGCTGGGAGCCGGG + Intronic
925278128 2:2665045-2665067 GGGACTGAGAGGTGGAAGCCAGG - Intergenic
925549962 2:5062766-5062788 GATCCTCAGGGGTGGCAACCGGG - Intergenic
926170247 2:10548688-10548710 CGCCCTCAGTGCTTGCAGCCTGG + Intergenic
931864960 2:66399588-66399610 TGGTCACAGTGGTGGCAGCCTGG - Intergenic
932213159 2:69948517-69948539 AGGCCGCAGTGGGGGCAGCTTGG + Intergenic
932288271 2:70554288-70554310 GGGCCGCAGTGGCGGCTTCCAGG + Intergenic
933098536 2:78220546-78220568 GGGCCTCAGAGGCTGTAGCCTGG - Intergenic
934681610 2:96287693-96287715 GGCCCTCTGTGGTGGAGGCCAGG - Intronic
934766409 2:96882546-96882568 GTGCCTCTGTAGTGCCAGCCAGG - Intronic
935128959 2:100247241-100247263 GGGCCTCAGTGGTGGCTGTGGGG + Intergenic
936056742 2:109267643-109267665 AGACCTCAGGGGTGGCAGCTGGG - Intronic
938066590 2:128284966-128284988 GGGCCACAGTGATGACATCCTGG - Intronic
941089080 2:161153659-161153681 GGGCCTCACTGTTGTCACCCAGG - Intronic
942795566 2:179814613-179814635 GGCCCTCAATGGTGGCGACCTGG + Intronic
944891558 2:204122716-204122738 TGGCCTCCCGGGTGGCAGCCTGG + Intergenic
946170620 2:217893151-217893173 GGGCCTCAGGGGAGGGAGGCAGG + Intronic
947530688 2:230907069-230907091 GGTTCTCTGTGGTAGCAGCCAGG - Intergenic
948461110 2:238130447-238130469 AGGCCTCAGAGGTGGCCCCCGGG + Exonic
948669978 2:239561968-239561990 AGGCCGCAGTGTTGGCAGGCTGG + Intergenic
948866219 2:240776100-240776122 AGGCCTCTGGGGTGGCGGCCTGG - Intronic
948903111 2:240965999-240966021 AGTCCTCAGTGGAGGCAGGCGGG + Intronic
1168928048 20:1598976-1598998 GGGCCTCTGGGATGGCATCCTGG - Intronic
1170635564 20:18101253-18101275 GGGCCTCAGAGCTGGGGGCCTGG + Intergenic
1172192512 20:33070556-33070578 GGGCCTCAGTGCTGTCACCATGG + Intronic
1172628618 20:36363468-36363490 GGTCCACAGCGGTGGCAGCAGGG + Intronic
1172846851 20:37934741-37934763 GGGCATCAGAGGTGGCATCATGG + Intronic
1173315237 20:41937193-41937215 GAGCCACAGGGGTAGCAGCCTGG + Intergenic
1173648781 20:44650271-44650293 GGGCATCAGTAGTGGGGGCCAGG + Intronic
1173769273 20:45644366-45644388 GGGCCTCAGTTCTGTCACCCAGG + Intergenic
1173857734 20:46261654-46261676 GGGACTCAGTGGGGGCAGACAGG - Intronic
1174097050 20:48097794-48097816 GTCCCTCAGTCGTGGCTGCCTGG - Intergenic
1174383469 20:50172309-50172331 GAGCCACAGTGGGGGCTGCCTGG + Intergenic
1174396208 20:50248263-50248285 AGGCCTTAGTGGTGGCGGGCAGG + Intergenic
1174456490 20:50652258-50652280 GGGCCTCAGGGTTTGGAGCCTGG - Intronic
1175327513 20:58140118-58140140 TGGCCTGAGTGCTCGCAGCCAGG + Intergenic
1175337040 20:58203438-58203460 GAGCCTCAGGGTTGGCAGGCTGG + Intergenic
1175883207 20:62272262-62272284 GGGCCTTAGGGGTGCCAGGCAGG + Intronic
1175901550 20:62361786-62361808 GGTGCTCAGGGCTGGCAGCCAGG + Intronic
1175916553 20:62428572-62428594 GGGGCTCAGAGGAGGAAGCCTGG + Intergenic
1176290979 21:5044448-5044470 GGGACTCAGGGAAGGCAGCCGGG + Intergenic
1176448461 21:6841457-6841479 AGGCCTCAGTGGTGGCTGCCAGG - Intergenic
1176826631 21:13706479-13706501 AGGCCTCAGTGGTGGCTGCCAGG - Intergenic
1178367411 21:31999105-31999127 GGGCTGCAGTGGGGGCAGGCTGG - Exonic
1178582368 21:33847594-33847616 GGGGGTCAGTGGTGGCAGCGTGG + Intronic
1179420503 21:41232508-41232530 GGGCCTCAGTGGAGGCATTTGGG + Intronic
1179866276 21:44219193-44219215 GGGACTCAGGGAAGGCAGCCGGG - Intergenic
1180052966 21:45341342-45341364 GGGGCTCAGTGGTGGCTGCAGGG - Intergenic
1180142189 21:45899397-45899419 GGGCCTCTGTATGGGCAGCCTGG + Intronic
1180167046 21:46035755-46035777 GGGCCTCAGGGATGGAAGCCGGG - Intergenic
1182115944 22:27756441-27756463 GGGGCTCAGTGGTGGAACCGTGG - Intronic
1182280669 22:29216245-29216267 GGGGCACAGAGGAGGCAGCCTGG + Intronic
1182424627 22:30265600-30265622 GGGCTTCAGGGCAGGCAGCCCGG + Intronic
1184111525 22:42398283-42398305 GGCCCCTAGTGGTGCCAGCCAGG + Intronic
1184814933 22:46862120-46862142 GGGCCTCAGTGATGACATTCAGG + Intronic
1185082639 22:48718337-48718359 GAGCCTCTGTGGGGGCAGCGGGG + Intronic
949469405 3:4379018-4379040 GTGCCACAGTTGTGTCAGCCTGG - Intronic
952543543 3:34395060-34395082 AGGCCCCAGTGGTGGAAGCATGG + Intergenic
953569021 3:44057091-44057113 GGGCCTCCTAGGTGGCAGGCAGG - Intergenic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
954559003 3:51539682-51539704 GGGTCATGGTGGTGGCAGCCTGG + Intergenic
955429862 3:58831677-58831699 GGGACTCACGGGTGGCAGGCAGG + Exonic
956894728 3:73648426-73648448 AGGCCCCAGTGGGGTCAGCCAGG + Intergenic
957508502 3:81156293-81156315 TGGCCAGAGTGGTGGCAGCATGG - Intergenic
958041406 3:88230744-88230766 GGGCCTGAGTGGTGGTTTCCAGG - Intergenic
960551304 3:118978558-118978580 AGGCTTCAGTGGTGGCAGCAGGG - Intronic
961455761 3:127023127-127023149 GGGCCTCTGAGGGGCCAGCCTGG + Intronic
961518201 3:127451524-127451546 AGGGCTCAGTGGTGGGAGGCGGG + Intergenic
962713126 3:138103941-138103963 GGCCCTCAGCAGTGGCAGCTGGG + Exonic
962739460 3:138352322-138352344 GGGGCTCAGTGCTGGGGGCCAGG - Intronic
963015951 3:140823969-140823991 CTGCCTCAGTGGTGGCAGACAGG - Intergenic
963311780 3:143717565-143717587 GGAGCTTAGTGGTGGCTGCCTGG + Intronic
966010075 3:175064444-175064466 GTGCCTCAGGGCTGGCATCCAGG + Intronic
968046620 3:195627667-195627689 GAGCCTGAGTGCCGGCAGCCTGG + Intergenic
968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG + Intergenic
968629329 4:1642059-1642081 GGGCCTCAGAGGTGGCTGTGAGG - Intronic
968902947 4:3439750-3439772 GGGCCTCAGGGGGGCCACCCTGG + Exonic
969180689 4:5438267-5438289 CGGGCTCAGTGGTGGGATCCAGG + Intronic
969532256 4:7736554-7736576 GGGTCCCAGTGGAGGCAGCGGGG + Intronic
969566824 4:7983684-7983706 GGGCCTCAGTGCAGGCTGCTCGG - Intronic
969627047 4:8311027-8311049 GGGGCTCAGTGATGGCTGCGTGG - Intergenic
969696687 4:8738877-8738899 GGGCATCAGGGGAGGCAGCGTGG - Intergenic
972468733 4:39383892-39383914 GGGCCTCAAGGGTGGTAGTCTGG - Intergenic
973756334 4:54077793-54077815 GGTCCTCACAGTTGGCAGCCGGG - Intronic
976679981 4:87745742-87745764 GCCCCTCAGTGCTAGCAGCCTGG - Intergenic
979649507 4:123114252-123114274 GGTCCGCAGGGCTGGCAGCCTGG + Intronic
982116610 4:152103697-152103719 TGGCCTCAGTGATGGGAGTCAGG - Intergenic
982523733 4:156452215-156452237 GGGCCACTGAGGTGGCAGCCAGG - Intergenic
985551515 5:535636-535658 GGGCCCCAGCGATGGCATCCGGG - Intergenic
985821891 5:2166205-2166227 GGGCCTGAGGGGTGCCAGCATGG + Intergenic
986739330 5:10692430-10692452 GGCCTTCAGTGGGGGCCGCCTGG + Intronic
986771035 5:10973818-10973840 GGGCCACAGTGGTGAATGCCTGG - Intronic
987518465 5:18947031-18947053 GTGCATCAGTGGTGGCGGGCAGG - Intergenic
988482711 5:31642905-31642927 TGGCACCAGTGGAGGCAGCCAGG + Intronic
988602114 5:32649684-32649706 GGCACTCAGGGGTGGAAGCCAGG - Intergenic
990042331 5:51389661-51389683 GGGCCGCAGGGCTGGCTGCCTGG - Exonic
992775032 5:80081857-80081879 GGCACTGAGTGATGGCAGCCAGG - Intronic
994741194 5:103621653-103621675 GCGCCTCAGTATTGGCAGCATGG + Intergenic
995574458 5:113514215-113514237 GGGCCTCAGCGGCGGCACCCGGG + Intronic
996088983 5:119331795-119331817 TGACCTCAGTGGTGGCTGCATGG - Intronic
997179650 5:131814881-131814903 GGCCCTCAGCAGTGGCATCCAGG - Intronic
1000292717 5:159885652-159885674 GTGCCTCAGTGGTGTCATCAAGG - Intergenic
1001398495 5:171433157-171433179 GGGCTTCAATGGTGGGAGCTGGG + Intronic
1001985711 5:176073227-176073249 GGTCTTCACTGGTGTCAGCCAGG + Intronic
1002231160 5:177764897-177764919 GGTCTTCACTGGTGTCAGCCAGG - Intronic
1002264177 5:178018851-178018873 GGTCTTCACTGGTGTCAGCCAGG + Intronic
1002882569 6:1265881-1265903 GGGTCCCAGTGGTCCCAGCCTGG + Intergenic
1003044000 6:2715951-2715973 GGGCAACAGTCGTGGTAGCCTGG - Intronic
1003305328 6:4922010-4922032 CTGCCTCTGTGGTGGCAGCTGGG + Intronic
1003567193 6:7231218-7231240 GGGCCGCAGTGGACGCAGCAAGG - Exonic
1006115883 6:31776021-31776043 GGGAGACCGTGGTGGCAGCCAGG - Exonic
1006361915 6:33591473-33591495 GGGACTCAGTGGTGGCTGAAAGG + Intergenic
1006400245 6:33813435-33813457 GGACCTCAGGGATGGCAGCTTGG - Intergenic
1006437128 6:34031494-34031516 GGGCCCCAGTGGGGGCACCAGGG + Intronic
1006948439 6:37801179-37801201 GGGCCCCCGTGCTGGCTGCCTGG - Intergenic
1007218968 6:40263453-40263475 AGGCTACAGTGCTGGCAGCCTGG + Intergenic
1007799598 6:44380909-44380931 GAGCCTCAGTGTTGGCTCCCAGG - Intergenic
1008048561 6:46876231-46876253 CTGCCTCAGGGCTGGCAGCCTGG - Intronic
1009889584 6:69664440-69664462 GGGCTTCTGAGGTTGCAGCCAGG + Intergenic
1015440420 6:133241217-133241239 GGGCCTCGGGGGAGGCCGCCAGG - Intronic
1018044609 6:159954788-159954810 GGGCCTAAGTGGGGCAAGCCAGG + Intergenic
1018485570 6:164238081-164238103 GGCCCCGAGTGGTTGCAGCCTGG - Intergenic
1019416883 7:931956-931978 GGGCCTGAGTGCAGGGAGCCAGG + Intronic
1019712102 7:2522467-2522489 TGGCCGCTGTGGTGGCAGCGCGG - Intronic
1020078296 7:5273178-5273200 GGGCCTCAGGGGTGGCTCCTTGG - Intergenic
1020246893 7:6436427-6436449 GGGCCTCTCTGGGGGCTGCCTGG - Exonic
1022036536 7:26539873-26539895 GGGCCACTGTGGAGGCAGCAGGG + Intergenic
1023054106 7:36278202-36278224 GGGAATCAGTGCTGTCAGCCTGG + Intronic
1023907116 7:44530931-44530953 GAGCCCCAGTGGAAGCAGCCAGG - Intronic
1025200600 7:56959012-56959034 GGGCCTCAGGGGTGGCTCCTTGG + Intergenic
1025671344 7:63617920-63617942 GGGCCTCAGGGGTGGCTCCTTGG - Intergenic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1026596317 7:71736798-71736820 GGGCCTGAGTGGGGGGAGGCGGG - Intergenic
1028428449 7:90718202-90718224 GTTTCTCAGTGGTGGCATCCTGG - Intronic
1029020934 7:97364267-97364289 TAGCCCCAGTCGTGGCAGCCAGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032387483 7:131534507-131534529 GGGCCACAGGGGTGGCCGGCGGG + Intronic
1032389531 7:131546913-131546935 GGGCCTCAGTGCGGGGAGGCAGG - Intronic
1032472822 7:132190656-132190678 GAGCCTCAGGGGTGGGGGCCTGG + Intronic
1033275954 7:139971714-139971736 GAGCCTCAGCAGTGGCAACCAGG + Intronic
1034499672 7:151441246-151441268 GGGCGCCAGTGGAGGCAGCTGGG - Intergenic
1034905764 7:154944406-154944428 GGGCCTCAGTTCTGGCCGCATGG - Exonic
1035231815 7:157469968-157469990 GGGCCACTGTGGTGGCCGGCAGG - Intergenic
1036890414 8:12592848-12592870 GGGGATCTGTGCTGGCAGCCAGG + Intergenic
1037589722 8:20302958-20302980 GGGCTTCAGAGGTCGCAGCTTGG - Intronic
1037777954 8:21848097-21848119 GGGCCTCAGTGGAACCAGCAGGG - Intergenic
1041313638 8:56540338-56540360 GGACCTCAGAGGTGGCTGCGAGG - Intergenic
1042043802 8:64624909-64624931 GGGACTCAGTGGGGGTACCCAGG - Intronic
1042258912 8:66836478-66836500 GGGGCTCTGTGGTGGTAGCTTGG + Intronic
1042660355 8:71148243-71148265 GGGCTTCAATGGTAGCAGCAAGG + Intergenic
1048469518 8:134695062-134695084 GGGCTTCAGGGGAGGGAGCCAGG + Intronic
1048799390 8:138182084-138182106 GTGCCACTGTGGTGGCAGCGTGG - Intronic
1049013053 8:139900379-139900401 AGGGTGCAGTGGTGGCAGCCAGG - Intronic
1049048861 8:140175373-140175395 GGACCTCTGTGGTAGAAGCCTGG - Intronic
1049275091 8:141716295-141716317 GGACCCCAGAGGAGGCAGCCGGG + Intergenic
1049308931 8:141923235-141923257 GGGCCTCACTGCTGGGGGCCGGG - Intergenic
1049354198 8:142179589-142179611 GGGCCTCAGGGGCGACAGCAGGG - Intergenic
1049582934 8:143420987-143421009 GGGCCACTGTGGGGGCAGCAGGG - Intronic
1049682568 8:143926242-143926264 GGGGTCCAGTGGTGGGAGCCAGG - Intronic
1050030629 9:1381764-1381786 GGTCCACAGTGGTGGCTGCTTGG - Intergenic
1051546274 9:18279795-18279817 GGGGCTCACAGGTGCCAGCCTGG + Intergenic
1053309840 9:37010821-37010843 GGGCCCCACAGGTGGCACCCAGG + Intronic
1053346157 9:37379946-37379968 GGGCCTCACTGGAGGCAGCTGGG - Intergenic
1054313228 9:63552503-63552525 GGGCCCCAGTATTGGCAGGCTGG + Intergenic
1055514045 9:77019561-77019583 GGGAATTAGTGGGGGCAGCCAGG + Intergenic
1056535051 9:87519647-87519669 GGGACACAGGGATGGCAGCCAGG + Intronic
1057030182 9:91769371-91769393 TGGCCTCCTTGGTGGCAGCCTGG + Intronic
1057353952 9:94320442-94320464 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353967 9:94320487-94320509 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353982 9:94320532-94320554 GGGCCTGGGTGGTGGCAGGCAGG + Exonic
1057519969 9:95752415-95752437 GGAGCTCAGTGGGGGCGGCCAGG + Intergenic
1057653783 9:96937103-96937125 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1057653798 9:96937148-96937170 GGGCCTGGGTGGTGGCAGGTGGG - Exonic
1059343058 9:113610410-113610432 GGGCCTGAGAGGTGGCAGGCTGG - Intergenic
1060655695 9:125371250-125371272 GGGACACAGTGGAGGCTGCCAGG + Intergenic
1060828000 9:126697269-126697291 GGGCCCAAATGGGGGCAGCCTGG + Exonic
1061618000 9:131792754-131792776 GGGCCTCTGTGCTTGGAGCCTGG - Intergenic
1062137827 9:134938996-134939018 GGGCCTGCGTGGTGGCCGCAGGG - Intergenic
1203520730 Un_GL000213v1:43061-43083 AGGCCTCAGTGGTGGCTGCCAGG + Intergenic
1186690312 X:11968450-11968472 GTGGTTCAGTAGTGGCAGCCTGG + Intergenic
1186973407 X:14873574-14873596 GGGCCTCAGAGGCGGCTTCCGGG - Intronic
1190309043 X:49103430-49103452 GGGCCTGAGGTGTGGCAACCAGG + Intergenic
1192002399 X:67167897-67167919 GGGCCTCAGAGAAGGCAGACAGG - Intergenic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1196998793 X:121415600-121415622 GCACCCCAGTGGTGGCAGCTGGG + Intergenic
1198480282 X:137034168-137034190 GGGCCCCAGGGGTGGGAACCCGG - Intergenic
1198522063 X:137463050-137463072 GGGACTCTGTGCTGGCAGACGGG - Intergenic
1200055171 X:153456456-153456478 AGGCCTCAGTGGCAGCACCCTGG - Intronic
1200093014 X:153644476-153644498 GGGCCTGAGTGGGGGCGGCCCGG + Intronic