ID: 954203098

View in Genome Browser
Species Human (GRCh38)
Location 3:49036939-49036961
Sequence TATGGCCCCCAGCTACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954203091_954203098 28 Left 954203091 3:49036888-49036910 CCCCATCTCTACAAAAAATACAA 0: 4126
1: 94416
2: 185410
3: 185009
4: 121101
Right 954203098 3:49036939-49036961 TATGGCCCCCAGCTACATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 109
954203093_954203098 26 Left 954203093 3:49036890-49036912 CCATCTCTACAAAAAATACAAAA 0: 6493
1: 211270
2: 146912
3: 70533
4: 147369
Right 954203098 3:49036939-49036961 TATGGCCCCCAGCTACATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 109
954203092_954203098 27 Left 954203092 3:49036889-49036911 CCCATCTCTACAAAAAATACAAA 0: 4530
1: 102448
2: 256591
3: 163839
4: 90505
Right 954203098 3:49036939-49036961 TATGGCCCCCAGCTACATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954203098 Original CRISPR TATGGCCCCCAGCTACATGG AGG Intronic
900202795 1:1418913-1418935 GATGGCCCCCAGCTCCCAGGAGG - Exonic
901082941 1:6593648-6593670 TTTGGCCCACAGGTACATGTGGG - Exonic
902185578 1:14722835-14722857 CATGGCACCCAGCTAAATGGAGG - Intronic
903328781 1:22586387-22586409 TGTGGCCCACAGCTTCCTGGGGG - Intronic
905621716 1:39454200-39454222 TGTGGACCCCACCAACATGGAGG - Intronic
909363391 1:74791358-74791380 CATGGCCCCAAGCTGCAGGGTGG + Intergenic
915924235 1:160004033-160004055 TGTGGCTCCCAGGTGCATGGTGG - Intergenic
916495707 1:165344894-165344916 TGGGGCCCCCAGCTCCAGGGTGG - Intronic
921311939 1:213853223-213853245 CATGGCCTTCAGCCACATGGTGG + Intergenic
923341873 1:233014654-233014676 TATGGCCATCAGGTACCTGGGGG - Exonic
1063325019 10:5090451-5090473 TATGGCTCTCAGCTACACTGTGG - Intronic
1063385508 10:5613925-5613947 TATGGCCTGCAGCTTCAGGGTGG - Intergenic
1063421489 10:5915977-5915999 TCTGGAGCCCAGCTTCATGGTGG + Intronic
1067731431 10:48814460-48814482 GATGGCCGCCAGCTACAGGCAGG + Intronic
1069616943 10:69812233-69812255 TCTGGAGTCCAGCTACATGGTGG + Intronic
1073935030 10:108620945-108620967 TAAAGCCCCCAGCTACAGTGTGG - Intergenic
1075420685 10:122298306-122298328 TATGGCCACCAGTGACCTGGGGG + Intronic
1077165176 11:1131543-1131565 TATGGTCCCCAGCTGCGTGGCGG + Intergenic
1077999847 11:7484973-7484995 TCTGGCCTGCAGCTACATGAAGG + Intergenic
1079560801 11:21816717-21816739 TATGGCCTCCAGCTCCATCTAGG + Intergenic
1079969385 11:27017843-27017865 TGTGGTCCCCAGCTAATTGGGGG - Intergenic
1081871907 11:46386812-46386834 CATGGCCCCCTGCCTCATGGGGG + Intergenic
1083680536 11:64349680-64349702 CATGGCCCCCAGCTCCCAGGCGG - Intronic
1087953805 11:104258454-104258476 TAAGGTGCCCAGCTACCTGGGGG - Intergenic
1088468844 11:110172831-110172853 TATTGTCACTAGCTACATGGTGG + Intergenic
1090266157 11:125354157-125354179 TATGGACCCCAGCTTCCTAGGGG + Intronic
1092160139 12:6311262-6311284 CCTGGCCCCCAGCTCCATGGTGG + Intronic
1093506748 12:19875553-19875575 TATGGTCCCCAGATCCATGGGGG + Intergenic
1095818874 12:46455118-46455140 TGTAGTCCCCAGCTACTTGGAGG - Intergenic
1103347417 12:120260378-120260400 TCATGCCCCCAGCTACTTGGGGG + Intronic
1103906014 12:124327566-124327588 TATGGCCTCCAGCCCCATGTTGG + Exonic
1106165539 13:27242526-27242548 TAAGGCCCCCAAGTAAATGGAGG + Intergenic
1106360999 13:29030398-29030420 AATGGTCCCCAGATACAGGGAGG - Intronic
1108097362 13:46917512-46917534 TATGGCCTCCAACTACATTCAGG + Intergenic
1110332609 13:74289951-74289973 TAGGGCCTCCAGCTACATCAAGG - Intergenic
1110536916 13:76661173-76661195 AATGGCCTCCAGCTACATCCAGG - Intergenic
1114891288 14:26926784-26926806 TATGGCACCCCGCTAGGTGGTGG + Intergenic
1118341668 14:64898906-64898928 AAAGGGCCCCAGCTACATGAAGG + Intergenic
1122645049 14:103188822-103188844 AATGGCCCCCAGCTCTATTGCGG - Intergenic
1123501890 15:20893808-20893830 TGTGGCCCTCATCCACATGGTGG - Intergenic
1123559143 15:21467507-21467529 TGTGGCCCTCATCCACATGGTGG - Intergenic
1123595374 15:21904788-21904810 TGTGGCCCTCATCCACATGGTGG - Intergenic
1126319393 15:47405688-47405710 TGAGGCCCCCAGCTAGATGAGGG - Intronic
1128214851 15:65927426-65927448 TGTGGCCATCAGCTATATGGAGG - Intronic
1131881899 15:96870901-96870923 TATGTCAGCCAGCTCCATGGCGG + Intergenic
1202967491 15_KI270727v1_random:194666-194688 TGTGGCCCTCATCCACATGGTGG - Intergenic
1134016922 16:10895297-10895319 TAGGGGCCCCAACTCCATGGTGG - Exonic
1134408197 16:13981325-13981347 TATTGCGCCCAGCCACAAGGTGG + Intergenic
1142168455 16:88606576-88606598 TGTGGCCCCCAACTACTCGGTGG - Intronic
1148963146 17:51410265-51410287 TGTGGGTCCCAGCTACTTGGGGG - Intergenic
1151876684 17:76870926-76870948 AATGGCCCCCAGCTGCCTTGGGG + Intronic
1161414775 19:4139820-4139842 TATGGCTCCCACCTCCTTGGAGG - Intergenic
931677012 2:64707492-64707514 AATGGCCTCCAGTTCCATGGAGG + Intronic
934922766 2:98359387-98359409 TATGGCAACCAGCTGCATGCTGG - Intronic
935624769 2:105163067-105163089 TCTGGCCCCCAGATAAACGGAGG - Intergenic
945891503 2:215435914-215435936 TCTGGCCCCCACCTTCTTGGAGG - Exonic
946012334 2:216575477-216575499 TATGGTCACCAGTTTCATGGTGG + Intronic
946549315 2:220783162-220783184 GAGAGCCCCCAGCTAAATGGAGG - Intergenic
1170591814 20:17777205-17777227 TCTGGCCCCAAGCTTCATGTGGG + Intergenic
1173849911 20:46211269-46211291 CAGGGACCTCAGCTACATGGTGG + Intronic
1175666867 20:60868698-60868720 GATTGCCCCCTCCTACATGGTGG - Intergenic
1175760845 20:61561401-61561423 GATTGCTCCCAGCCACATGGCGG + Intronic
1176124824 20:63470758-63470780 TTTGGCCCCCAGCCAGGTGGGGG + Intronic
1178576661 21:33798717-33798739 ACTGGTCCCCAGCTACATAGTGG + Intronic
1179879616 21:44287905-44287927 CCTGGCCCCCAGCTGCATGCAGG + Intronic
1180024301 21:45150611-45150633 GAGGGCCTCCAGCTACATTGGGG + Intronic
1181385483 22:22542331-22542353 GATGGCACCCACCTACATGGAGG + Intergenic
1181828095 22:25536051-25536073 TGTAGTCCCCAGCTACTTGGGGG + Intergenic
1183018202 22:35007111-35007133 TATGGACCCCAGGTAAATGGAGG + Intergenic
1183216543 22:36483928-36483950 AAGGGCTCTCAGCTACATGGTGG + Intergenic
1183252652 22:36741258-36741280 TTTGCTCCCCAGTTACATGGGGG + Intergenic
1183814337 22:40287129-40287151 TGTAGTCCCCAGCTACTTGGAGG - Intronic
950669066 3:14514364-14514386 TTTGGCCTCCAGCTCCAGGGCGG - Exonic
952456191 3:33474265-33474287 TGTAGTCCCCAGCTACTTGGGGG + Intergenic
954203098 3:49036939-49036961 TATGGCCCCCAGCTACATGGAGG + Intronic
962605202 3:137026981-137027003 TTTCAACCCCAGCTACATGGAGG - Intergenic
963472784 3:145763731-145763753 AATGGCCTCCAGCTACATACAGG - Intergenic
972232572 4:37092873-37092895 TATGGCTCTTAGCTACATTGTGG - Intergenic
975494018 4:75018225-75018247 TTGGGTCCCAAGCTACATGGAGG + Intronic
975904995 4:79199100-79199122 TCTGGCGACCAGCTACAGGGAGG - Intergenic
979160897 4:117459796-117459818 GATGGTGCCCACCTACATGGTGG + Intergenic
981651323 4:147062266-147062288 CATTGCCCATAGCTACATGGGGG - Intergenic
981859228 4:149334780-149334802 TTTGGTCACCAGCTACAAGGAGG + Intergenic
983853096 4:172607431-172607453 GATGGCCCCCAGCTGCATCCAGG + Intronic
986191715 5:5502659-5502681 GATGGTGCCCACCTACATGGAGG - Intergenic
988541015 5:32109754-32109776 TGTGACCCCCAGATTCATGGAGG + Exonic
988964296 5:36401112-36401134 TATGGCTCCCTGCCACATAGTGG + Intergenic
990371020 5:55118532-55118554 TATGGCCTTCAGCTAGGTGGGGG - Intronic
995015652 5:107306068-107306090 TAGCTCCCCCAGCTACCTGGGGG + Intergenic
995574222 5:113512898-113512920 TGTGGCCCCCAGCTAACTGCAGG + Intergenic
999298742 5:150477073-150477095 TATGGCCCCTAGGTACTGGGAGG + Intergenic
1004509555 6:16274293-16274315 TTTGTCCCCCAGCTGCCTGGTGG + Intronic
1004733648 6:18383686-18383708 TATGGCCACCACCTAAATGATGG + Intergenic
1005682420 6:28219609-28219631 TGTGGTCCCCAGCTACCTGGGGG + Intergenic
1006299524 6:33186148-33186170 TCTGGCCCCCACCTACCTGGAGG - Intronic
1008772232 6:54992539-54992561 CATGGCTCTCAGCTACATTGTGG + Intergenic
1012001493 6:93660748-93660770 GATGGCCCCCACCCACATGATGG - Intergenic
1012002239 6:93667422-93667444 GATGGCACCCACCTACATTGAGG - Intergenic
1012386567 6:98689965-98689987 TTTGTCCCCCAGCTTCAAGGGGG - Intergenic
1015062217 6:128980129-128980151 CATGGCCACCAGCTACACTGAGG - Intronic
1016397588 6:143641982-143642004 CATGGCCAACAGCTACATAGAGG + Intronic
1017232702 6:152090504-152090526 TGTGTCCCCCATCTCCATGGAGG + Intronic
1018265944 6:162024317-162024339 AATTACCCCCAGCTACCTGGGGG - Intronic
1020006926 7:4788199-4788221 CAGGGCCCCCAGCTGCCTGGAGG + Exonic
1021958390 7:25849681-25849703 GATGGCCTACAGCTACACGGAGG - Intergenic
1026086580 7:67268010-67268032 TCCTGCCCACAGCTACATGGGGG + Intergenic
1034274631 7:149818645-149818667 CATGGGCCCCAGCCACCTGGGGG - Intergenic
1038898868 8:31819114-31819136 TGTAGTCCCCAGCTACTTGGTGG + Intronic
1038995711 8:32920747-32920769 TCTGGTCCCCAGCTACAAGATGG - Intergenic
1044076358 8:87826315-87826337 TATGGTCAGCAGCTACAAGGAGG - Intergenic
1045371457 8:101528523-101528545 CATGTTCCCCAGCTACATGTGGG - Intronic
1047095136 8:121616798-121616820 TATGGCCCAAAGGTATATGGTGG + Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1059762888 9:117355802-117355824 CATGGCCCCCAGCTGCAAGCCGG - Intronic
1061292923 9:129662460-129662482 TATAGTCCCCAGCTACTTGGAGG - Intergenic
1061542752 9:131287130-131287152 TATAGCACCCAGATACAGGGAGG - Intergenic
1203791451 EBV:153906-153928 TGTGGCCCCCATCTCCCTGGAGG - Intergenic
1190279865 X:48922498-48922520 TCTGGCCTCCAGCTGCATGGAGG - Exonic
1192340186 X:70257922-70257944 TCAGGCCCCCAGCTACATGCGGG + Intergenic
1195647135 X:107245274-107245296 GATGGCACCCACCTACATTGAGG + Intergenic
1199242263 X:145561053-145561075 AATGGCCCCCAGCTCCATCCAGG - Intergenic