ID: 954210411

View in Genome Browser
Species Human (GRCh38)
Location 3:49093930-49093952
Sequence TGCAGCGGAGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5576
Summary {0: 1, 1: 6, 2: 180, 3: 1910, 4: 3479}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954210411_954210422 4 Left 954210411 3:49093930-49093952 CCGCCGCCGCCGCCTCCGCTGCA 0: 1
1: 6
2: 180
3: 1910
4: 3479
Right 954210422 3:49093957-49093979 CCGGCCCCGCCGCACCGCCAGGG 0: 1
1: 0
2: 2
3: 20
4: 230
954210411_954210420 3 Left 954210411 3:49093930-49093952 CCGCCGCCGCCGCCTCCGCTGCA 0: 1
1: 6
2: 180
3: 1910
4: 3479
Right 954210420 3:49093956-49093978 GCCGGCCCCGCCGCACCGCCAGG 0: 1
1: 0
2: 2
3: 44
4: 548
954210411_954210426 11 Left 954210411 3:49093930-49093952 CCGCCGCCGCCGCCTCCGCTGCA 0: 1
1: 6
2: 180
3: 1910
4: 3479
Right 954210426 3:49093964-49093986 CGCCGCACCGCCAGGGACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954210411 Original CRISPR TGCAGCGGAGGCGGCGGCGG CGG (reversed) Exonic