ID: 954213687

View in Genome Browser
Species Human (GRCh38)
Location 3:49112359-49112381
Sequence CAGGCTGCACACTTGGAGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954213680_954213687 0 Left 954213680 3:49112336-49112358 CCTCCGACTGTTGCTTCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG 0: 1
1: 0
2: 2
3: 15
4: 193
954213679_954213687 26 Left 954213679 3:49112310-49112332 CCGGGTACAGCGCTTCAGCTTTT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG 0: 1
1: 0
2: 2
3: 15
4: 193
954213682_954213687 -3 Left 954213682 3:49112339-49112361 CCGACTGTTGCTTCCGCTGGCAG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG 0: 1
1: 0
2: 2
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954213687 Original CRISPR CAGGCTGCACACTTGGAGAT GGG Exonic
900421703 1:2558594-2558616 CAGGGTGCATCCATGGAGATGGG - Intronic
901179281 1:7330062-7330084 CAGGCAGCAGACATGGAGATAGG + Intronic
901765393 1:11496764-11496786 CGGGCTGCAGACTGGGAGGTGGG + Intronic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
904468209 1:30720206-30720228 CAGGCTGAACACCTGGAGTCTGG + Intronic
906151923 1:43592532-43592554 CTGGCTGCACGCTCGGATATGGG + Exonic
906197419 1:43937461-43937483 CAGGCTGCTCACTTGGGCCTGGG + Intergenic
910034269 1:82771839-82771861 CAGGCAGCAGGCTTGAAGATGGG + Intergenic
910609162 1:89121855-89121877 CAGGCTGCGTAATTGCAGATAGG + Exonic
913329769 1:117657514-117657536 CAGTCTCCATACTGGGAGATGGG + Intergenic
915717392 1:157957305-157957327 AAGGCTGCCTGCTTGGAGATGGG + Intergenic
918525907 1:185464747-185464769 CAGGCTGCAGCCTTGGGCATTGG + Intergenic
918803926 1:189014628-189014650 CAAGTTGCTCATTTGGAGATAGG + Intergenic
919796072 1:201322280-201322302 CAGGGTGCACTCTGGGAGCTGGG + Intronic
920833158 1:209483280-209483302 CAGGTTGCACAGTTAGAAATTGG - Intergenic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
921901736 1:220458164-220458186 CTGCCTGCACACTGGGAGAATGG + Intergenic
922807851 1:228399778-228399800 GATGCTGCAGACTTGGAGGTGGG + Intronic
1067427699 10:46222090-46222112 CAGGCTGGACACTGGGTGATAGG - Intergenic
1067583119 10:47457981-47458003 CAGGCTGGACAGTGGGTGATTGG - Intergenic
1067949585 10:50718993-50719015 CAGGCTACAAACTTCAAGATAGG + Intergenic
1069726572 10:70583817-70583839 CAGGCTGCACACGAGTAGCTGGG + Intergenic
1070406301 10:76100466-76100488 CTGCCTGCACACTGGGAGAAAGG - Intronic
1070884893 10:79884014-79884036 CAGGCTACAAACTTCAAGATAGG + Intergenic
1071062242 10:81585873-81585895 CAACCTGCACATTTAGAGATTGG + Intergenic
1074939108 10:118217411-118217433 CAATTTGTACACTTGGAGATGGG - Intergenic
1075613748 10:123875653-123875675 CAGGCACCATACTTGGGGATTGG - Intronic
1075744253 10:124715561-124715583 TAGGCTGCACACGTGGAGGGGGG - Intronic
1075973309 10:126673252-126673274 CTGGATGGACAATTGGAGATGGG + Intergenic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1078930529 11:15909028-15909050 CAGGCAGACCACTTAGAGATAGG + Intergenic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082889937 11:58127860-58127882 CAGGCTGCAGTCTTGGACATTGG - Intronic
1084147854 11:67274614-67274636 CAGGCTGTGCACTGGGAGACTGG - Intronic
1084942429 11:72620169-72620191 CAGGCTGCACACCTGAAGGTGGG - Intronic
1086559782 11:88154481-88154503 CAGGCTGGACACCTGCAGTTTGG - Intronic
1086997251 11:93372295-93372317 CAGGCTGAATATTTGGAGGTGGG - Intronic
1087840098 11:102911731-102911753 CAGCCTGCGCACTGGGAGAACGG + Intergenic
1088704339 11:112448099-112448121 CAGCCTGCACCCTTGGGGGTGGG - Intergenic
1090750206 11:129739986-129740008 CCAGCTGCACACTTGGATTTTGG - Intergenic
1091058656 11:132441820-132441842 CAGGTTGCATCCTTGGGGATAGG + Intronic
1091315584 11:134611719-134611741 TAGGGTGCAGACTTGGAAATGGG + Intergenic
1095766350 12:45899788-45899810 CAGGCTCCCCCCTTGGAGGTGGG - Intronic
1096242154 12:49965303-49965325 CTGGCTGCACAGTTAGAGAGGGG + Exonic
1096518898 12:52173254-52173276 TGGGCTGCAGAGTTGGAGATGGG - Intronic
1096795712 12:54076331-54076353 AAGGCTGCAGACTAGGAAATGGG + Intergenic
1101561381 12:105861021-105861043 CAGGCTTCACCCTGTGAGATTGG - Intergenic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1103031273 12:117615424-117615446 AAGACTGAAGACTTGGAGATGGG - Intronic
1103503762 12:121426351-121426373 CAGGCTTGATACTTGGAAATTGG + Intronic
1104770212 12:131356794-131356816 CAGGCGTCTCATTTGGAGATGGG + Intergenic
1105305150 13:19163272-19163294 CTGACTGTACACTTGGAAATGGG + Intergenic
1108890202 13:55248546-55248568 CAGGCTTCATAGTAGGAGATTGG - Intergenic
1110213058 13:72995358-72995380 CTGGCTGTATTCTTGGAGATAGG - Intronic
1114182960 14:20380969-20380991 GTGGCTGCACACTTGGAATTGGG - Exonic
1117049622 14:51847175-51847197 CAGGCTGCAGACTGGGAGGGTGG + Intronic
1117799491 14:59428352-59428374 CAGGCTGCTCCCTGGGAGCTGGG + Intergenic
1119435694 14:74596510-74596532 CAGGCTGCACTCAGGGAGCTGGG + Intronic
1122205335 14:100145423-100145445 CAGGCTGCCCACTCGGACATGGG + Exonic
1123189672 14:106556974-106556996 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123201195 14:106666115-106666137 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123212616 14:106775195-106775217 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1124086082 15:26551815-26551837 CAGGCTGAGTGCTTGGAGATGGG + Intronic
1125640962 15:41230670-41230692 CAGGCTGAAAACCTGGAGAAAGG + Exonic
1126054242 15:44714525-44714547 CAGGCTGATCACTTGAAGTTGGG + Intronic
1126113908 15:45191557-45191579 CAGGCTCTGCACTTGGTGATGGG - Intronic
1128386217 15:67150506-67150528 CAGACTGCACGCTTGGGGGTGGG - Intronic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1130171828 15:81523011-81523033 CAGGTTCCAGACTTGGAGCTGGG - Intergenic
1130744452 15:86635919-86635941 GAGTCAGCACAGTTGGAGATAGG + Intronic
1131378257 15:91943126-91943148 TAGGCTGCACACTTACAAATGGG - Intronic
1135788091 16:25368387-25368409 CGGCCTGCACACTGGGAGAATGG + Intergenic
1135995620 16:27245529-27245551 CAGGCTGCAGACATGAAGAACGG + Intronic
1136567587 16:31079503-31079525 CAGGCTGCCCCCATGGCGATAGG - Exonic
1137249061 16:46729794-46729816 CAGGCTGCACTCTGGGATGTAGG - Intronic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1143100808 17:4503725-4503747 CAGCCTGGGCACTTGGAGTTGGG + Intronic
1144409763 17:14989405-14989427 CAGGCTGAACATGTGGAAATTGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1145917474 17:28583946-28583968 CAGGTTGCTCACCTGGAGCTGGG - Exonic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1147543510 17:41380594-41380616 CAGGCTGCCCAAGAGGAGATAGG - Intronic
1147661737 17:42120677-42120699 CAGGCAGCGCCCTTGGAGCTGGG - Intronic
1149988816 17:61368839-61368861 CACGCTGGAGACTTAGAGATTGG + Intronic
1152511760 17:80794799-80794821 CATGCGCCACCCTTGGAGATGGG - Intronic
1152534672 17:80943573-80943595 CAGCCTGCACACTGGGACAACGG - Intronic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1156309529 18:35909283-35909305 CAGGCAGCAGGCTTGGAGAGAGG - Intergenic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1157836987 18:50913558-50913580 CAGGCTGATCACTTGGAGTCAGG - Intronic
1160922419 19:1527117-1527139 CATACTGCACACTTGGCGACAGG - Intronic
1160927448 19:1553720-1553742 CAGGCTGCAGGCTTGGGGAGTGG - Intergenic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161795641 19:6385040-6385062 CAGGCTGGGCACGTGGAGAGCGG - Intronic
1162849121 19:13417102-13417124 CAGGCTGCCCCCTTGGGGAGAGG - Intronic
1163303135 19:16460614-16460636 CAGGCTCCACAATTGCTGATGGG - Intronic
1165374190 19:35430023-35430045 CAGGCTGAACACCTGGAGAGGGG + Intergenic
1165382598 19:35491831-35491853 TAGGGTGCCCAGTTGGAGATGGG + Intronic
1166762843 19:45235476-45235498 CAGGGTGGTGACTTGGAGATGGG + Intronic
1168071401 19:53954219-53954241 GAGCCTGCAGACTTAGAGATAGG - Intergenic
925146206 2:1584858-1584880 CCGGCTGCGCAAATGGAGATAGG + Intergenic
927606156 2:24489314-24489336 CGGGCTGCAGAGTGGGAGATTGG + Intergenic
928206690 2:29289685-29289707 CAGGCTCCAAAGTTGGAAATGGG - Intronic
928375271 2:30768578-30768600 AAGGCGGCACACCTGGAAATAGG - Intronic
929773608 2:44913834-44913856 CAGGCTGCAGCCTTCTAGATAGG - Intergenic
930116792 2:47725011-47725033 CCCGCTGCCCATTTGGAGATAGG + Intronic
930308827 2:49712284-49712306 CAGTGTGCCCCCTTGGAGATGGG + Intergenic
935229387 2:101082625-101082647 CATGCGGGACACTTGAAGATAGG + Intronic
936463464 2:112727618-112727640 CAGGCTGCACACTTGGCTTTTGG - Intronic
936733249 2:115408298-115408320 CCGCCTGCGCACTGGGAGATTGG - Intronic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
942537557 2:176981397-176981419 CAGGCTATACCCTTAGAGATAGG + Intergenic
943140156 2:183972159-183972181 CATGCTACTCACTTGGGGATAGG + Intergenic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
948681118 2:239635253-239635275 CAAGCTGCACACTGGAAGATGGG - Intergenic
948870700 2:240796482-240796504 CAGGATGCACTGTGGGAGATTGG - Intronic
1169464800 20:5827589-5827611 CAGGCTGCAGACTGGCAGAATGG - Intronic
1171209210 20:23304172-23304194 CAGGCAGATCACTTGAAGATAGG - Intergenic
1171570791 20:26249437-26249459 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1172271768 20:33659186-33659208 CAAGCAGCACCCTTGGAGACAGG - Intronic
1174082323 20:47979325-47979347 CAGGCCCCACACTCGGAGAGGGG - Intergenic
1174783114 20:53408208-53408230 CAGACTCCAAACTTGGAGAACGG - Intronic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1180076283 21:45464821-45464843 CAGGCTGTGGACCTGGAGATGGG - Intronic
1180572951 22:16746453-16746475 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1181837989 22:25626771-25626793 CAGGCTGCAGGTTTGAAGATCGG + Intronic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
949878315 3:8641608-8641630 CAGGCTGCACACTTCGGGAGGGG - Intronic
952840721 3:37643117-37643139 CAGATTGCACACTTGGAGTCAGG + Intronic
953441121 3:42918444-42918466 CTGCCTGCACACTGGGAGAACGG - Intronic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954395937 3:50293330-50293352 CAGACGGCAGCCTTGGAGATTGG - Exonic
957104741 3:75872465-75872487 CAGCCTGGTCACTTGGAGAGAGG - Intergenic
958766551 3:98375470-98375492 CAGGCTGCACTCAAGGGGATAGG + Intergenic
959811320 3:110622985-110623007 CAGGATGCAACCTTGTAGATAGG - Intergenic
961823608 3:129587555-129587577 CAGGCTGGGCATTTTGAGATGGG + Intronic
963445835 3:145406558-145406580 CAGGCGGAACACTTGAAGTTGGG - Intergenic
963872315 3:150430644-150430666 GAGGCTGCAGACTTGCAGGTTGG + Intronic
964568085 3:158080483-158080505 CATGCTGTACACTTTTAGATTGG + Intergenic
967531034 3:190549249-190549271 CAGCCTGCGCACTGGGAGAATGG - Intronic
969664270 4:8548123-8548145 TAGGCCCCACACATGGAGATGGG + Intergenic
975849876 4:78561168-78561190 CAGGATGGACCCTTGCAGATAGG + Intronic
976724525 4:88202658-88202680 CAGCCTGTACACTGGGAGAACGG - Intronic
988711095 5:33775718-33775740 CAGGCTGCAGGCTTGGGGAAGGG - Intronic
989111800 5:37913825-37913847 CCAGAGGCACACTTGGAGATGGG + Intergenic
992097452 5:73376215-73376237 CAGGCAGCTCACTTGGAGCCGGG + Intergenic
992380256 5:76229354-76229376 CAGGCTGGACAATTAGAAATGGG + Intronic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
996709025 5:126525731-126525753 CAGCCTGCACACTGGGAGGATGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
999726758 5:154444945-154444967 CATGCTGCGCAGTTGGAGAGTGG + Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1004885612 6:20049120-20049142 CAGCCTGCACACATGAAGGTAGG - Intergenic
1004978738 6:20998288-20998310 CATACTGCACACTTGGAGCTGGG - Intronic
1005074378 6:21892110-21892132 CAGGCGGCACACTTGAAGCCAGG - Intergenic
1009570795 6:65381413-65381435 CAGTGTGAACACATGGAGATAGG + Intronic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1013508249 6:110820462-110820484 CAGGCAGCTCACCTGGAGGTCGG - Intronic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1014533068 6:122583287-122583309 CAGGCAGCAAACTGTGAGATAGG + Intronic
1021813599 7:24426611-24426633 TATGCTGCACACTTGCAGTTTGG - Intergenic
1022529861 7:31060068-31060090 CAGGCTGCTTACTAGGAGACAGG - Intronic
1022616560 7:31936979-31937001 CAACCTGCCCATTTGGAGATGGG - Intronic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1026481750 7:70785506-70785528 CTGCCTGTACACTTGCAGATGGG - Intronic
1028447511 7:90942029-90942051 AAGGCTGGACATTTGGGGATGGG + Intronic
1035333703 7:158112635-158112657 CATCCTGCACACGTGGACATGGG + Intronic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037395454 8:18437012-18437034 CAGGCCTCACACTCGGATATTGG + Intergenic
1037692513 8:21194172-21194194 GAGGCTGCACCCTTGGAGTGAGG + Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1047817845 8:128484223-128484245 CAGGCTGATCACTTGGAGTCAGG - Intergenic
1048939688 8:139388096-139388118 CATACTGCACACTTGAAAATGGG - Intergenic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1050785243 9:9392928-9392950 CAACCTGCACACTGGGAGAATGG + Intronic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1053785342 9:41649007-41649029 AAGGCTGCAGACTAGGAAATGGG + Intergenic
1054159687 9:61665166-61665188 AAGGCTGCAGACTAGGAAATGGG - Intergenic
1054174067 9:61862959-61862981 AAGGCTGCAGACTAGGAAATGGG + Intergenic
1054448924 9:65392026-65392048 AAGGCTGCAGACTAGGAAATGGG + Intergenic
1054663471 9:67717822-67717844 AAGGCTGCAGACTAGGAAATGGG - Intergenic
1056782576 9:89562297-89562319 CAGGCTGGGCTGTTGGAGATGGG - Intergenic
1058587833 9:106529840-106529862 CAGCCTCCACAGTAGGAGATGGG + Intergenic
1058900407 9:109437654-109437676 CATGCTCCCCACTTGGACATAGG + Intronic
1059608713 9:115868313-115868335 GAGGCTGCACTCTTGTAGTTAGG - Intergenic
1061008058 9:127939443-127939465 CAGACTCCATAGTTGGAGATGGG - Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1062393301 9:136342577-136342599 CAGGCTGCACACCTAGAGCCTGG + Intronic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1187649189 X:21381696-21381718 CAGCCTGCATACTTGGTGCTGGG - Intronic
1192366816 X:70480606-70480628 CAGGCTGCAGACTGGGAGCAAGG - Intronic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1195965497 X:110426678-110426700 CAGGCTTCATACCTGGAGCTCGG + Intronic
1197872770 X:131074980-131075002 CAGGAAGCACACTTCTAGATGGG - Intronic
1198090672 X:133326171-133326193 CAGGCTGCACACTTGTAATGGGG - Intronic
1198798142 X:140421520-140421542 CAGGCTGCTCATTTGTAGTTTGG - Intergenic
1200081770 X:153580464-153580486 CAGGCTGCACCCTTGTTGAATGG - Exonic
1202345492 Y:23919388-23919410 CAGGCAGCACACTTGAAGCCAGG - Intergenic
1202525278 Y:25750701-25750723 CAGGCAGCACACTTGAAGCCAGG + Intergenic